Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4394
Length(NT) : 514
Best Gene Model Blast : Link to GSTUMT00005277001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_09385
Accession: ref|XP_001799680.1| Score: 281 E_value: 8e-24
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g469 Score: 260 E_value: 1e-21
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2615 Score: 205 E_value: 2e-17
PFAM Definition: No Hit Found

Sequence:
>Contig4394
TTGGCACTACACAGGCACTCGTTACCGCGAGGAATGCTGCGGCAACGTAT
AGCTGTGATTGGGTGTTGACTCTACTGAGAAGGAAGAAGCTGATACCAGC
ACTCGCTAGCCCGGTCTTTACAACTAAAATTGGTGGGTATTTCCTAACAA
ATGAGCCCTGGAGAGCTGAGGCCAGAAGGCCGACAAATCCGAGAAGCTTG
CCAGAATCCGCGGAGGTGTAATTGAACAAGTCAAAGGTCATGAATGGTAG
GGAGAACTCCATTCCGGAGAATATAAGGAGAAACAAGAAGTGTGTAAGGT
TCAAGAGAAAGATGCTCGACCCCTCTGGTGATCCTTCTGACTTCTTTTTA
TCCCCAGTCCCCTTTCCAGACTTGTTCTCCCGCTCTGGTTGCTCAACCTT
GCTGGGCTCTTCATTCAGAGGGCGGGTCTCCGGTAGCTTCCAGTACAAAA
ACGCCGTCTCTACTACCAAAAGTACCAACGAGAACACAGCTGCGGCTGCG
AAAGGGTTCTCCAA

Sequences in the Contig:

SY0AAA50YL08FM1 SY0AAC31YJ24FM1