Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4393
Length(NT) : 608
Best Gene Model Blast : Link to GSTUMT00006412001 E-value : 1e-118
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG05100.1
Accession: ref|XP_385276.1| Score: 215 E_value: 1e-42
KEGG Definition: hypothetical protein
Accession: ncr:NCU07673.1 Score: 201 E_value: 1e-43
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2743 Score: 199 E_value: 1e-16
PFAM Definition: cobW, CobW/HypB/UreG, nucleotide-binding domain. This domain is found in HypB, a hydrogenase expression / formation protein, and UreG a urease accessory protein. Both these proteins contain a P-loop nucleotide binding motif. HypB has GTPase activity and is a guanine nucleotide binding protein. It is not known whether UreG binds GTP or some other nucleotide. Both enzymes are involved in nickel binding. HypB can store nickel and is required for nickel dependent hydrogenase expression. UreG is required for functional incorporation of the urease nickel metallocenter. GTP hydrolysis may required by these proteins for nickel incorporation into other nickel proteins. This family of domains also contains P47K, a Pseudomonas chlororaphis protein needed for nitrile hydratase expression, and the cobW gene product, which may be involved in cobalamin biosynthesis in Pseudomonas denitrificans..
Pfam Number: pfam02492 Score: 150 E_value: 6e-11
Swissprot: Q9BRT8|CBWD1_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig4393
TTGGGAAATGAGCTCCGATCACCTTGACCTTGACGATGAGGAGCCCCCAG
CTCTAGTTTCGACTGAAACTCTCCTCAGCCTCGAAGACCTTCAGCTATCA
AAGGCACCGATAACAATTGTCACGGGATACTTGGGAGCTGGGAAAACTAC
CCTCTTAAACTATATCCTTACTGAGCAACATTCAAAGAAGATCGCAGTCA
TTTTAAACGAATTTGGAAACTGTGAGCTCATCCCCTAATGCCCGACAGAA
ACCCTTCCGTTGCGGGTCAAGCTTGGAATATTTTGTTAATGATGAAGACA
ATTTGACTGGGCGGTTTTGAATAGCAAGCGATATCGAAAAATCGTTAACC
ATCCAGAGAGATGGTCAGCAAGTTGAAGAATGGCTGGAGCTAGCAAATGG
CTGTATTTGCTGCTCAGTAAAGTAGGCTTTACCCCTGCCTCCTCAATGGT
CTCTGTTTGCCAACTTTAGGTTGTAGGGACATAGGGGTAGCGGCCATCGA
AAAACTTATGGAACGCCGGGGCAAGTTTGATTACATCCTTCTAGAAACGA
CTGGGCTCGCAGACCCTGGAAATATAGCGCCTATGTTTTGGCTAGACGAA
GGCCTTAA

Sequences in the Contig:

SY0AAC31YJ09FM1 SY0AAD41YL13FM1