Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4392
Length(NT) : 1270
Best Gene Model Blast : Link to GSTUMT00003586001 E-value : 0.0
Numbers of ESTs : 20

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64848.1| Score: 877 E_value: 3e-92
KEGG Definition: predicted flavoprotein involved in K+ transport
Accession: aor:AO090011000332 Score: 877 E_value: 2e-92
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 199 E_value: 3e-16
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 134 E_value: 1e-08
Swissprot: P64746|Y916_MYCBO

Sequence:
>Contig4392
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTTTCCTCCATCGTAGCGG
CTCTGCAAAGGGCCACGTGGTGTCAATCAGCAATTCTCTCATCACTCTGA
CAACAGAACACACTTTATCCAATATCCATGTCACCGCCACCAAAATACAC
AGACGTTGTCTGCATTGGCACCGGTCTCTCAGGGATTGCACTCGGCGCAC
GCCTAAAGACCCACTACCCGCACGCGAGCGCGCACTTCTACGACCGGAAT
ACAAACCTGGGTGGGACCTGGCATGCGAATACGTACCCAGGCGCCGCGTG
CGATGTCCCGAGCGTGCTCTACAGCTTTAGCTTCGCCATGAATGCTGCCT
GGTCGTGCATAACACCGCCGCAGGAGGAGATCAAGGAGTATGCGCTAGGG
GTCGCGAGGGAGTATGGGATTCCCGAGAGGGCGACCTTAGGGGCCGAGGT
TTTGGGCTGTGAGTGGGTGGAAGGGAGGGGGGTTTGGAAAGTTAGGGTTC
GGAGGAAGGGACAGGGGGAGGAGAAGGAGGAGTGGGAACATGAGTGCCGG
GTGCTGTTTAGTGCTGTTGGGGGGTTGGTATATCCGAATGTTCCGGAGGT
GGATGGGATGGAGGAGTTCCAGGGGAGGATTTGCCATTCGGCAGAGTGGG
ATCAGGCTATTGAGTTTAAAGGCAAGGACGTAGTAGTCGTTGGCAATGGC
TGCACCGCCTCACAAATCGTCCCGGCGGTTGCAGAGGTCGCTGCGTCGGT
AACCCAGATCGTCAGGAGCGCGCATTGGCTAGTCAAGGCTCCTAAAATAA
ATTACACTCCAAGGATCCAATGGATATTCCGGAACATCCCGTTGGTAAAC
CGACTTCACAGATTCCTGATATTCCTTGTGATGGAGGACGCTTTCCATCT
CTTCGGTGGTAGCGAGAGCTCTAAAAAGTATCGAGCGAGGCGAAGGCCTG
TGTTGGAAAAATACATGCGGGAGGCATCGCCGGAAAAGTATCACGACATA
TTAATCCCCGATTATGAGGTCGGGTGTAAACGAAGAGTCCTCGACGTTGA
CTACCTAAAATGCCTCCACAACTCACACGTAACCCTAGCCAAATCCGCCA
TAACGCGAATAACCCCAACCGGCATCCAAACTTCCACCGACACACACTAC
AAAGCACAAGTAATAATCTTCGCAACCGGCTTCAAAACTTGCTACTTCCC
GTTGCGCATAATCGGCAGACAGGGTGTCAGCATGACCGATCACTTTGCCG
GATTAGGTGGTCCGGGCGCG

Sequences in the Contig:

SY0AAC15YN10FM1 SY0AAC19YA01FM1 SY0AAC30YK16FM1
SY0AAC31YJ07FM1 SY0AAC36YA02FM1 SY0AAC43YF08FM1
SY0AAC47YK05FM1 SY0AAC49YJ15FM1 SY0AAC5YH12FM1
SY0AAC5YJ18FM1 SY0AAC60YN08FM1 SY0AAD1YM22FM1
SY0AAD30YA17FM1 SY0AAD50YE05FM1 SY0AAD51YO21FM1
SY0AAD52YC17FM1 SY0AAD57YG05FM1 SY0AAD57YK03FM1
SY0AAD61YP06FM1 SY0AAD8YP12FM1