Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4391
Length(NT) : 1828
Best Gene Model Blast : Link to GSTUMT00008056001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: RNA binding protein Jsn1
Accession: ref|XP_749690.1| Score: 1529 E_value: 1e-167
KEGG Definition: RNA binding protein Jsn1, putative
Accession: afm:AFUA_2G05610 Score: 1529 E_value: 1e-168
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4574 Score: 821 E_value: 4e-88
PFAM Definition: No Hit Found
Swissprot: O60059|YG58_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig4391
TTGGGCTGCTGCTAATGGAAACGACACCCGCGACAGCGTTGCAGCACTCA
AATTGCCTGATCTGATTGATATGAGGGAAGATATTGTCAAGATTGTACAG
GAATTTGGTGCGGAGCATGATGATGCTTTGATGGTGGGAAACAACATTGA
TAAGGCTGTTGAATATCAGAATTTTGAGCCTGAAATCCCACCAATCCCGG
AGCCAACCCACAATCGCGTTCATGACGCGCCTAAATTGCGTGATATCAGG
AAACGGATTGATAATGGAAATTGCTCGCAAACTGAAATTGAGGAGATCGC
GATGACCATGTTGGATGAGATTGCCGAACTCTCTAGTGATTACCTTGGAA
ACACTGTTGTACAGAAGCTCTTTGAATACTGCTCTGAGGAGATCAAGGGG
GCGATGTTGGTAGAGATCGGTCCCCACCTTGCCGAAATTGGAATCCATAA
GAATGGCACTTGGGCTGGGCAGAAAATCATTGATGTCGCTAAAACCCCTG
CTCAAATGCAGAAGATTTGTGATTGTCTCCGACCCTATACCGTCGCTCTG
TTCCTCGACCAATATGGAAACTACGTTCTTCAATGCTGCCTTCGCTTTGG
CGCCCCGTGGAACGACTTTATTTTCGAGACCATGTTGAGCCGTATGTGGG
AAATTGCACAAGGAAGATTCGGTGCTCGAGCAATGAGGGCATGTCTCGAG
AGCCATCATGCAAGCAAAGACCAGCAAAGAATGCTCGCTGCTGCTATCGC
TTTGCACAGCGTCCAGCTCGCCACAAATGCGAATGGCGCTTTGTTGCTGA
CTTGGTTTCTGGACACCTGCACATTCCCTCGTCGTCGCACAGTTCTCGCA
CCACGTTTGGTTCCGCATCTTGTGCATCTTTGCACGCACAAGGTTGCTTA
TCTGACTGTGTTGAAAGTTATTAATCAGAGGAACGAGCCAGAGGCGCGTG
ACACAATCCTTAAGGCCCTATTCTTCTCGCCTGGAGATAAAGTGCTGGAA
GATATTCTCAGTGATCATTCATGTGGAGCAACTCTTATTTTCAAGGTTCT
TACCACACCATTCTTTGAGGAGACGATGCGGAGCGAAGTGGCTCAGAACG
TCCGGAACGTCCTGCTCAAGCTGAAGGCTACCCCATCACAGGGGTACAAG
AGATTAATGGACGAAGTTGGATTGCCTACTCGCAATGGGGTTTCTAATAA
TGCCAATACTAGTAATGGACCGAAAGACCACCCACGGGATCGTGTTAACA
ATAATTCAAATGCCAGTAATGATCGCAGGGGAGTGCCCCAGAACTCTCCT
GCAAGCCATAACCACAATCATCATAATAATAATCGCGATCTTCCGCCAGT
ATCGTTTTATAATGTTACCCCTTCCAGCTTCGATCCGGCCGCCTTGGCAG
CTGCCGCTTCTCAGATGCCTCAAAATGCAGGATTCGACCCAGTCGCTTTA
AGGGCATTTGAGCAATTAAGCCTTACTGCAGGCTCACTTTATGGTACTCC
CGGCCCTCCTGGAATCAATAACCCCGCTCTTCAATATCAGGCCTTGTTGC
AACAATCGATGGGACGCTCAGGGCCAAATTTCTTCGGGATGTCCCCTTCG
ATGGGAAGCTATAATGGAGGGCAAGCTTCACAAGATCAGTACCGTGCTGG
CCATCCCGGTAGTTCTCCTGTACCTCAGCCACAGCAAATGGCGAATAACC
CGATGCTGGGGAGTATGGGTGCAACACCCGGAGTCTTCAACCCGTTGCAG
CTCATGACCGGATATCCTTATGGTGTTCCGGTATTCCAACCACCACAGCA
ACAGGGCCACAGTGCTGGAAGTGGAAGA

Sequences in the Contig:

SY0AAA54YB06FM1 SY0AAA57YC10FM1 SY0AAB20YL09FM1
SY0AAB28YI18FM1 SY0AAB40YP01FM1 SY0AAB48YG23FM1
SY0AAB58YH09FM1 SY0AAB7YH08FM1 SY0AAC11YJ21FM1
SY0AAC31YI12FM1 SY0AAC37YJ15FM1 SY0AAC3YO22FM1
SY0AAD28YN12FM1 SY0AAD56YD19FM1