Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig439
Length(NT) : 2135
Best Gene Model Blast : Link to GSTUMT00003160001 E-value : 0.0
Numbers of ESTs : 154

Blast Results:

Nr Definition: TATA-binding protein
Accession: gb|AAY23352.1| Score: 1021 E_value: 1e-108
KEGG Definition: TATA-box binding protein (TBP), component of TFIID and TFIIIB; K03120 transcription initiation factor TFIID TATA-box-binding protein
Accession: aor:AO090003000546 Score: 1014 E_value: 1e-108
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3302 Score: 795 E_value: 4e-85
PFAM Definition: TBP, Transcription factor TFIID (or TATA-binding protein, TBP)..
Pfam Number: pfam00352 Score: 335 E_value: 9e-32
Swissprot: Q12731|TBP_EMENI

Sequence:
>Contig439
TTGGCCAACTTTTTTGTACTAGGGTCTCCTCCACGCGTAAACATCATATC
CCCGTTTTGTCCATCACCTTGACAAGACCCGAAATATCGACTTCTACAAC
GACCTGATCAGTGTTCGTTCTGCTTGAAGCGATCTCTCTACTCTTCTCAA
ATTCACTCCTTTTGTTCCTTTTCCACATCGCCACACGGTCACATCCGAGC
GATTAGTCAGCGTGGTGAGAGGCACTTGTCAGACATCGATCTTTCAACAA
TAGAATCCATCACCATCTCATCACCCTTCCCGTTCACGATTCGTCTATTG
CAGATTAGAACGGCTACACTCTCTACAAGCCCCATATCACCTTTAGTAAA
GTAGGGGAGACATTTGGTTGTTCTTCTCCTCGACCAACCTCATTGCCCTA
AACCGCTTTTTCCTGATACCCCGCTCCGTCACCATTACATCAACTTACCC
TCCCGTCAACTCCACACATCCGAAGCCTTTTCCTCAACCATCCGCAACCT
CATCAACCGCTTCGTCCATCAAAAAACAACAACTTCCATTATCGATCTTA
ATCATGGCGGCTATTATTTCCCACCCCCAGAATGCCCAGCAAGCCAAGGC
TTTCACTAGCCCCGCTTCTTTGTCTTTTCCCGGTGGTGCTGGCGACTTGA
CTCCTCCATCCGACGTGGAGAGTCATAAAGCCCAAATGAACGGGCAGCAA
GTCAACGATCAGTCCGGAGGAGTTGTTACTCCCGCGACCCCGGCTGCAAC
CCCAGGTGGTGGACCAACCGTTAGTGGTATTGTGCCTACATTGCAAAACA
TCGTCGCAACCGTCAATCTTGATTGTCGATTGGATCTGAAGACGATTGCC
CTGCATGCTAGGAACGCAGAATACAACCCCAAGCGTTTCGCCGCTGTTAT
CATGCGTATTCGCGAACCTAAAACCACTGCACTCATTTTCGCATCCGGCA
AGATGGTTGTCACCGGTGCCAAATCTGAAGATGATTCCAAGCTCGCCTCG
CGCAAATACGCTCGCATCATCCAAAAACTTGGGTTCAATGCTAAATTCAC
GGATTTTAAGATCCAGAACATTGTTGGCTCCTGTGATATCAAGTTCCCCA
TTCGCCTCGAGGGTCTCGCCTCTCGCCATCATCACTTCAGCTCTTATGAG
CCTGAATTGTTCCCGGGGTTGATCTACAGAATGATTAAGCCTAAGATTGT
TCTGCTTATCTTTGTGAGCGGGAAAATTGTTTTGACGGGTGCGAAAGTTC
GCGAGGAGATATACATTGCCTTCGAATCCATCTACCCTGTGCTCAATGAT
TTTAGAAAAGTTTAAATCTTTAGGGTTCATTACAACGTTATCTTTTCCCT
TGTACTATTACCTCTTCTCTCTTTTATGACTGCATGACATCTCATCAAAA
GTAAATTGGGAGGGCTCATTCCGGTTTCAAATAGGTAAAGCAGTTCACCG
CGACAACAGTCGATGGAGGACGCTTTCACCGTTGCTATATTATTTTGCAT
CGTCCGGGGTGTTTTTGTTTTGGGTTCCTTTTTTCCATTTCCTTTTTTAC
TTACTATCACATGGGTATGGGTTGTATTTCTGGAGCATCGCACTTTTATT
AGAACCCCTTGTTTTGTGAATCCACCAGCATTTCCCCCCTCTTTTTTTTT
TTTTTTTTTTTTACCTCTCTTCAGTGATCCCAAGCGGTTAGGCCGACCTA
CGGCTTTGCCTGCAGGTCGGCAGTCCGGCCAGTCCGGCCAAGATTTTGAA
GAGCCTGGTTCAGTCCGGCTTGAATTTTGTCCGGCCGCCAAAACCTGCAG
GCACCCAGGCAACCGCCCGGCTGTGGGGCTTGGCAGTAGGGGTCCAAACT
GCCAGATACCCAGGTAAAGCCGCCAGATGCCCAGGCAATGCCATAAAATG
CCTAGGCAAAGCCGCTAGATGCCCAGGTAAAGCCGCCAGATGCCCAGATA
AAGCCGTCAAATGCCCAGGCCAGGCTTTTTTTCTGGAAAGCCGCTTTCCC
ACAGTTCGTCAGGCCATCCCCTAAAAGGTGGTGGGTCAGTCCGGCCGTAC
CCAAAGCCGGACGGACTGGCTGCTTGGGATCACTGCCTCTCTTTCACTCA
TCTTTTTCCCCTTACACTTCTTTATCATGTGTCAT

Sequences in the Contig:

SY0AAA10YJ10FM1 SY0AAA10YO15FM1 SY0AAA11YK22FM1
SY0AAA11YN17FM1 SY0AAA12YL06FM1 SY0AAA15YF03FM1
SY0AAA20YK24FM1 SY0AAA20YK24RM1 SY0AAA21YF03RM1
SY0AAA24YB16FM2 SY0AAA27YI11FM1 SY0AAA28YN21FM1
SY0AAA30YN09FM1 SY0AAA32YJ17FM1 SY0AAA34YB14FM1
SY0AAA34YJ08FM1 SY0AAA37YG13FM1 SY0AAA37YL02FM1
SY0AAA38YI06FM1 SY0AAA38YN12FM1 SY0AAA39YJ07FM1
SY0AAA3YM23FM1 SY0AAA42YO16FM1 SY0AAA44YD17FM1
SY0AAA44YO23FM1 SY0AAA46YC04FM1 SY0AAA47YG01FM1
SY0AAA48YJ24FM1 SY0AAA48YL03FM1 SY0AAA52YC01FM1
SY0AAA58YO21FM1 SY0AAA60YA19FM1 SY0AAA61YJ09FM1
SY0AAA62YI12FM1 SY0AAA63YG23FM1 SY0AAA7YO18FM1
SY0AAA8YP18FM1 SY0AAA9YO13FM1 SY0AAB10YL21FM1
SY0AAB10YM18FM1 SY0AAB11YE17FM1 SY0AAB13YI13FM1
SY0AAB15YI23FM1 SY0AAB19YI22FM1 SY0AAB23YD08FM1
SY0AAB25YA08FM1 SY0AAB25YA09FM1 SY0AAB25YO08FM1
SY0AAB26YF08FM1 SY0AAB27YI20FM1 SY0AAB29YF02FM1
SY0AAB29YM18FM1 SY0AAB29YP09FM1 SY0AAB2YJ23FM1
SY0AAB2YK03FM1 SY0AAB31YO07FM1 SY0AAB32YH04FM1
SY0AAB36YO11FM1 SY0AAB38YA14FM1 SY0AAB38YK01FM1
SY0AAB39YP06FM1 SY0AAB42YJ21FM1 SY0AAB42YK10FM1
SY0AAB49YJ10FM1 SY0AAB49YO18FM1 SY0AAB50YA21FM1
SY0AAB52YF15FM1 SY0AAB54YP07FM1 SY0AAB55YA22FM1
SY0AAB55YD23FM1 SY0AAB56YE18FM1 SY0AAB5YG23FM1
SY0AAB6YD15FM1 SY0AAB7YP02FM1 SY0AAC11YP21FM1
SY0AAC12YA22FM1 SY0AAC13YM08FM1 SY0AAC15YO16FM1
SY0AAC16YH16FM1 SY0AAC17YM22FM1 SY0AAC18YK17FM1
SY0AAC21YB12FM1 SY0AAC21YB12RM1 SY0AAC22YK20FM1
SY0AAC23YH22FM1 SY0AAC24YE06FM1 SY0AAC24YN12FM1
SY0AAC26YK14FM1 SY0AAC26YK24FM1 SY0AAC27YJ14FM1
SY0AAC28YH04FM1 SY0AAC28YJ05FM1 SY0AAC29YB02FM1
SY0AAC30YH11FM1 SY0AAC31YD03FM1 SY0AAC31YE23FM1
SY0AAC31YN19FM1 SY0AAC34YA24FM1 SY0AAC36YC12FM1
SY0AAC36YG06FM1 SY0AAC3YM07FM1 SY0AAC40YP21FM1
SY0AAC48YH21FM1 SY0AAC49YP19FM1 SY0AAC53YH03FM1
SY0AAC53YO02FM1 SY0AAC55YH04FM2 SY0AAC56YO07FM1
SY0AAC57YD03FM1 SY0AAC58YE02FM1 SY0AAC58YJ03FM1
SY0AAC58YJ17FM1 SY0AAC5YO04FM1 SY0AAC60YP13FM1
SY0AAC6YE17FM1 SY0AAC6YF15FM1 SY0AAC7YE08FM1
SY0AAC9YC17FM1 SY0AAC9YN22FM1 SY0AAD10YI09FM1
SY0AAD11YD02FM1 SY0AAD12YL23FM1 SY0AAD18YA24FM1
SY0AAD21YH03FM1 SY0AAD21YM01FM1 SY0AAD23YB17FM1
SY0AAD23YO23FM1 SY0AAD24YI17FM1 SY0AAD29YE10FM1
SY0AAD2YB16FM1 SY0AAD32YF19FM1 SY0AAD35YH22FM1
SY0AAD36YG09FM1 SY0AAD36YL04FM1 SY0AAD36YM12FM1
SY0AAD38YP11FM1 SY0AAD39YI05FM1 SY0AAD40YI05FM1
SY0AAD41YC18FM1 SY0AAD41YI07FM1 SY0AAD43YP20FM1
SY0AAD44YD15FM1 SY0AAD46YA08FM1 SY0AAD49YG04FM1
SY0AAD49YI09FM1 SY0AAD4YJ04FM1 SY0AAD51YD19FM1
SY0AAD51YL14FM1 SY0AAD53YB07FM1 SY0AAD55YB02FM1
SY0AAD56YM20FM1 SY0AAD60YL03FM1 SY0AAD7YP03FM1
SY0AAD9YN19FM1