Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4389
Length(NT) : 1751
Best Gene Model Blast : Link to GSTUMT00007542001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: calmodulin-binding protein kinase
Accession: gb|AAG43970.1| Score: 1493 E_value: 1e-163
KEGG Definition: calcium/calmodulin dependent protein kinase, putative
Accession: afm:AFUA_3G09550 Score: 1438 E_value: 1e-157
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0032 Score: 734 E_value: 5e-78
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 646 E_value: 8e-68
Swissprot: Q9P7I2|KCC1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004683 = Molecular function: calmodulin-dependent protein kinase activity
GO:0019722 = Biological process: calcium-mediated signaling
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>Contig4389
CCTTTCCCGCAACGGCCGCCCCCCCCGTTCACCGCACTCGCCCATTATCA
AAACCAAAATCCTCAGATATCGCAGAGAGGGAACCAGTTATCCGATGTAA
CTCCAGACCTTCAAAAATTCTGCCGCAGAAGATGAGTTCGAGTGCTGATT
ATCTGGATTGTTCGGAACCTTGTGTTATAATAGGGTTGGTGAGCTTCCTG
AGATTTGAGATGCTGTTGAGGTACTGCTGAGGTATTTTGGTGGTTTTAGA
GCTCCTTTTTACCACAGGCGCGGTGTGCTTGCCGATGAGGGTCCTCGCCG
TCCCCTAAGATAGTAGATAGTTTGGAAAGAAAATGGGGACTACGGTCCTA
AACGCTATCTTTATGGATTCCCCCAAAGCTATATTCGGTGGGCGGAAGAG
GTGAAACGCTAGGAGGCTGAGGGCCTTCTCTGGGCTCTGGGAATGAGAGT
CGATTCTATGGTTCCCAGGCGCAAGTACTCGAGCAGGACCTGTCTGATCC
CTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAGGTAATGTG
AATTGCAGAATTCAGTGACACTCTCCTATCGCTTGATATTGAAACCAGAA
ATCTACTACCCCTACTTCCGTCCCTTTTGTTGCTGACTGGAACCAGCTTA
GACCCCGTCCAAGCTATTGATCTGCACATCGTCGCTTCCCATAACAATTC
TCTAACCGAGCTATCAAACTGCAATGAGCGCGGTCCCCGAAAACTCATCG
GCCCCCCAAAAACCACAGGTCCAACCTTGCCGTTACAAGACTGGTAAAAC
ACTTGGCTCGGGGAGTTACAGTGTCGTGAAAGAGTGTGTCCATATTGACA
CAGGGAGGTATTATGCTGCAAAGGTCATTAACAAGAGACTCATGGTTGGA
AGGGAGCACATGGTTCGAAACGAAATCGCTGTTTTGAAGAAGGTTTCTAT
GGGTCATCAAAATATTCTCACTCTGGTAGATTATTTCGAGACTATGAATA
ATCTTTACCTTGTCACCGATCTTGCTCTCGGAGGAGAATTGTTTGACCGG
ATTTGTCGGAAGGGATCCTATTACGAGTCTGATGCATCCGATCTCATTCG
CGCCACTCTATCGGCAGTTGCTTACTTGCACGATCACGGGATCGTGCACA
GAGATTTGAAGCCCGAGAACCTGCTTTTCAGGACTGCGGAAGATAATTCA
GATTTGCTGATTGCTGATTTCGGCTTATCTCGAATAATGGATGAGGAGCA
GTTCCATATATTGACCACAACATGCGGTACACCGGGATATATGGCACCCG
AAATCTTCAACAAGACTGGTCACGGGAAACCAGTTGATGTTTGGGCTATC
GGTGTTATTACATACTTCCTCCTCTGTGGATACACACCCTTCGACAGGGA
TAACCATGTAGATGAGGTAACTGCGATCTCCCAAGCAGACTACAAATTCG
AGCCAGAAGACTACTGGAAAGATGTCTCTGAAACAGCTCGGGACTTCATC
CGTGGTTGTTTAACCATAGATCCGAGTGCCCGCATGACCTGTCACAAGGC
CCTAGAGCACCCCTTCCTGGTGGAAGGGTACAGGGGCAATGACCTTCTCC
CTGTCGTTCGCAAAAACTTCAACGCTAGAAAAACCCTCCACGCTGCTATC
GACACTGTTAGGGCCATCCACAAACTGCGTGAGGGTGGGACAATGGATGG
CGCGCTGAGTATCAGCCCCGAAAGCCAGAAAGAGAAGGAGATAGAGAAGC
A

Sequences in the Contig:

SY0AAA13YL07FM1 SY0AAA25YP15FM1 SY0AAA30YJ05FM1
SY0AAA32YK23FM1 SY0AAA36YC10FM1 SY0AAB52YJ22FM1
SY0AAB55YO01FM1 SY0AAB61YK16FM1 SY0AAC21YG11FM1
SY0AAC25YK19FM1 SY0AAC31YH15FM1 SY0AAC54YG12FM1
SY0AAC59YL18FM1 SY0AAC60YG21FM1 SY0AAC61YJ23FM1
SY0AAC8YC23FM1 SY0AAD20YH23FM1 SY0AAD27YH09FM1
SY0AAD33YJ20FM1 SY0AAD52YI01FM1 SY0AAD53YM10FM1