Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4388
Length(NT) : 1777
Best Gene Model Blast : Link to GSTUMT00001753001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein AN6708.2
Accession: ref|XP_664312.1| Score: 1325 E_value: 1e-144
KEGG Definition: hypothetical protein [EC:2.3.1.12]; K00627 pyruvate dehydrogenase E2 component (dihydrolipoamide acetyltransferase)
Accession: ani:AN6708.2 Score: 1325 E_value: 1e-144
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0557 Score: 1204 E_value: 1e-132
PFAM Definition: 2-oxoacid_dh, 2-oxoacid dehydrogenases acyltransferase (catalytic domain). These proteins contain one to three copies of a lipoyl binding domain followed by the catalytic domain..
Pfam Number: pfam00198 Score: 752 E_value: 3e-80
Swissprot: P20285|ODP2_NEUCR
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix

Sequence:
>Contig4388
TTGGGGGGACAACTTTGTACAAAAAAGTTGGTCTCAACCCATTCTCCCAC
CATCCTCCTACTCCCCACACCCCTTTCCTCATCCTCCCCCACCGATCCGG
CTCGGAATTGATCCATTTGCAATGATGTCGGCTACTGTGGTTCTTGGTAG
AGCATCGTTGCGCAGTGTTTCTGTTTGCTTGAGGGGCGGTGGTATTAAGA
GTGCTGGATTATTGAGACTTCGAAACCAACCCCAATCGCTCTCCTCACTG
CTTTCCAGATACTATGCGTCAAAAACATACCCCCCTCATACTGTTGTTAC
CATGCCCGCTCTGTCCCCTACCATGACTTCGGGGAATATTGGCTCATGGC
AGATGAGCGTTGGTGATACCATTGCTCCTGGTGATTCCTTGGTTGAGATC
GAGACGGATAAGGCTCAGATGGACTTCGAATACCAGGAGGATGGCGTCCT
GGCTAAGATCCTGAAGCCCAGTGGGTCTACAGACGTTGCCGTTGGAAATC
CGATTGCTGTCATCGTTGAAGACGGGACAGATATATCTGCCTTTGGAGAC
TTTACCGTTGAAAGTGCTGAAGGAGGGGCCGGGGCTCCCCCGCCGCCCGA
GGGGGAATCTCTGGATTCTCCCGAACTCCCCAAGTCTGAGGAGCCAGCTT
CTAGCGGGGGCAGACTAGAAACTGTTTTGGAGCGTGATGGAAGAATCATT
GCTTCCCCTCTCGCCAAGAAGATTGCATTGGAGAAGGGAATCGCGTTGAA
AGGCATTAAGGGGACTGGAGAAGGCGGTCGCATTACCAAATATGATGTCG
AGAATTACGAATCGACTGGAATTTCCTCTGCGTCCGGCATGCCTGCTGTT
GTAAGCACTGATATTCCGTTGACATCTATGCGCAAGACAATTGCATCTCG
TCTCCAGGCTTCGAAGAACACCAACCCTCACTACTACGTCTCAGCTTCTC
TCTCTGTGAGCAAGCTTCTCAAACTCCGCCAGGCTCTCAACACCTCTGCC
AAGGGAGAATACAAGCTTTCTGTTAATGACTTCCTAATTAAGGCTGTTGC
CAATGCATTGCTCAAGGTTCCCACTGTCAACTCTTCTTATCGTGAGGATG
AGGGTGTCATTCGCCAATTCTCCACCGCCGACATTTCTGTTGCTGTTGCT
ACCCCGGTTGGCCTGATGACTCCCATTGTCAAGAATGCCGACGCCAGAGG
TTTGGTTTCGATCTCTAACGAGGTCAAGTCCCTTTCTGGAAGAGCTAGAG
ATGGAAAGCTTAAGCCCGAGGAGTACCAAGGGGGTACTTTTACCATCTCA
AACATGGGAATGAATCCCGCTGTTGAAAGGTTCACTGCCATCATCAACCC
CCCACAGGCTGGAATCTTGGCTGTCGGAACTATTAAGAAGGTTGCCGTTG
AGGGCAAAGACGGAGGTGTTGAATGGGACGAGCAGATTGTTGTTACTGGA
TCCTTCGATCACAGGGTTGTAGATGGTGCCGTTGGTGGGGAATTCCTTAG
AGAACTCAAGAAGCTCATTGAGAGCCCCCTAGAAATGCTCCTATAGGAGT
TCTCTTTGCCCAATTCTCATTTCCCTTTCCTTCACCCCGTCAAGTAGGTT
AATCTCATGAATTGGTGTCACGAGTTTTGCATAGACGAAGTAAACTAGTA
ACGATAACCAAACGCATCCGAATGCTGTCAATGGTGGGAGCGTGTTTCCT
CGGTATGGCTGTATAATCCATCACTATTTCCCTTCTTTTTTCTCTTCAGA
TTTCCTTGCTTTTTTTCCCCCCTTTTT

Sequences in the Contig:

SY0AAA13YM01FM1 SY0AAA57YE07FM1 SY0AAA7YP10FM1
SY0AAB12YD21FM1 SY0AAB6YI15FM1 SY0AAC31YH10FM1
SY0AAC56YJ22FM1 SY0AAD22YD12FM1 SY0AAD26YA07FM1