Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4387
Length(NT) : 678
Best Gene Model Blast : Link to GSTUMT00009827001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: tRNA-splicing endonuclease subunit sen34
Accession: ref|XP_001274408.1| Score: 271 E_value: 2e-22
KEGG Definition: tRNA-splicing endonuclease subunit sen34 [EC:3.1.27.9]; K01170 tRNA-intron endonuclease
Accession: afm:AFUA_5G11140 Score: 264 E_value: 7e-22
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4133 Score: 194 E_value: 6e-16
PFAM Definition: No Hit Found
Swissprot: O60156|SEN34_SCHPO

Sequence:
>Contig4387
TTGGATTATCTCTTATACAAATCAGAGACAAATTACAGTGATACAAGACA
ACCCTCTAGGATCGAGGAGGGCATCTAGTAGAATTCTGTACTCTTGGTTA
CACCAGTACCGTACTTGTAGCCCTTGCAGGAGCCGCAGCTACAGCCCAAT
GACTACCCCTACAATTCCGCAGGAACCATTCCCAATTTACCTTGTCAGCT
CCAGCTACCTCCTCTACGACGCCACTGTAATTTCCCACGTCCGCCGCACA
CACCGAATGTCCGGCTGCCTGACTGGCACCCTCCCACAGATCCCACAACA
AAACATATTCCTTGGCCTACCTTTAGAGCTAATGATCGAGGAGGCGCTGC
TTCTTGTTGATAAAGGCGCCGGATACATTGTTGACGACGTACACGTTCAC
GAGCACGGCCTGCGGGACATGCTAGAAGTGGATAAACATCAATTTTTGGA
AGAGCGAGAGGAAGGTCAGAGGAGGGGTGTAGAGGAGTATGTCAGGAAGG
TGCAGGAGAAGAGGGGTGTTTTTGTTCAGGGTCGGGGTAACGATGAGGGG
GGAGGGGTGGATGGTGGTGGGCAAGGGACTGAAGGCGGACGGGGCGATGT
GGCCGAGGGGGAAACGGTGTTCGAGAATTCATCGGTATCAAACTCGAGAC
CGGCTGCTACGACAGCTGTACCAGCTCC

Sequences in the Contig:

SY0AAC31YH05FM1 SY0AAD42YG11FM1