Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4386
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00001600001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_08004
Accession: ref|XP_001553811.1| Score: 398 E_value: 4e-37
KEGG Definition: hypothetical protein
Accession: ang:An16g08620 Score: 364 E_value: 2e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q10222|PTA1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4386
TTGGACTACCACCACTCAGCTATTTCACACGACTATCCTCGTAGCCTTCC
TTTTGTTTCAACCAACTCTTCACACACACATCGACACACACCAGCGCCTC
TCCCAGTTAAGTGAACAACAACTGGGGGGGAAAGAAAAGGAAGAAGGAAA
AGAAGGACAAAACAAAGAGGGGGGAAATAATAAAAAATAAGAAATAGAGC
TTTCCGGATCTTCAGAATTATTACAACAATGGCAGCCGCGCAGGGTCTTA
GCTCCGTCGAGGATCAACTTCAACAACTAGGAAGTGCGCGCGCCCTTGTT
CTAACCGATCCAGTCTACTGGCCGCAGGTACTACACGGTATCCTCCCAAT
CGTATCCGGACCTGTTGTCGAGCTGAGGCGTTGGGGTGCGGACTTTCTCG
CTGAGACCTTTTCCACCCCTGTGGTCGAGGCCGGGGAGAAGTTGAATCTT
GCGGTTGCTTGCCTGGATACAATGGTTAGGTTGATGGATGAGAGAGAGGC
AGGCATTCTTAAGAGCGTCGTCCAGTGTAGTGCTTCCGTATACCCGCTCA
TATTCAGATATATATGCAATAATCGAGAAGATGCAGCCACATGGAAGAAA
ATGGATGTATTGAAGTCGAAGATCCTGAGTCTCTGGGACACCGGCCCGGT
GGGGGTACGCCTTTGCTGTATCAAGTTCGTACAGAGGGTAATATTAGT

Sequences in the Contig:

SY0AAB45YO07FM1 SY0AAC31YH03FM1 SY0AAD11YJ04FM1