Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4385
Length(NT) : 2363
Best Gene Model Blast : Link to GSTUMT00000601001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SS1G_02222
Accession: ref|XP_001596006.1| Score: 1964 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ncr:NCU04090.1 Score: 1944 E_value: 0.0
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1933 Score: 1244 E_value: 1e-137
PFAM Definition: Patched, Patched family. The transmembrane protein Patched is a receptor for the morphogene Sonic Hedgehog. This protein associates with the smoothened protein to transduce hedgehog signals..
Pfam Number: pfam02460 Score: 459 E_value: 5e-46
Swissprot: Q12200|NPC1_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology
GO:0005515 = Molecular function: protein binding
GO:0046624 = Molecular function: sphingolipid transporter activity
GO:0006665 = Biological process: sphingolipid metabolic process

Sequence:
>Contig4385
TTGGACAACATCTTCTTGATCGTTCACGAGTTCGAAAGAGTCAACTATTC
CCATCCGGATGAGAGAGTGGAGGTTCGCGTTGGGAAGACAATAGGCAGAA
TGGGCCCGAGCATTTTACTCTCTGCAACTTGCGAAACTATCGCCTTTGCA
CTGGGAGCTGTCGTCTCTATGCCTGCGGTGAGGAACTTTGCGATTTATGC
CGCCGGCGCAGTATTCGTCAATGCTCTTTTGCAGGTTACCATGTTCGTGG
CCGTATTATCGTTGAACCAGAAGAGGGTCGAGAGCAACAGGATGGATTGT
TTCCCCTGCTTTAGGGCGCCTGGCGGCTATGAGAGTAATGGCTCTGCTGC
TACTGTTGGAGGAGGCATAATGTCGAATCTAAGGGGAGAGGGAATTAGAA
ATGCACCTGGATTCTCTATGGAGGAGGAAGGAGTTTTGCAGAAATTTATA
AGGAAGGGATATGCGCCCGCTCTATTGCAGAAACGGACTAAGCGGGTTGT
CGTGAGCTTGTTTTTGGGGTTTTTCGCCGCCGGAATCGCACTTTTGCCAA
AGGTCGAGCTTGGGCTGGACCAGAGAATTGCCATTCCCAGTGATTCATAC
TTGATTGGCTACTTCAACGACCTTTACGATTACCTGGACGTTGGGCCACC
AGTCTACTTTGTGACCAAGGATTATAACGTTACCGCCAGGGAAGAGCAAC
AATCACTTTGTGGGCGCTTCTCGACGTGTGATACATTTTCACTGTCAAAT
GTTTTAGAACAGGAGAGAAAACGTCCCGAGATTTCATATATTGCAGAACC
TGTTGCTAGTTGGATCGACGACTTCTTTCTATGGTTGAATCCTTCCCTCG
ATCGTTGTTGCAGAGTCAAGAAGAGGAATCCTTCCGAGCTCTGCGATGAG
CTCGATAGCGATCGCGTCTGCAAGGTCTGCTTCGAAGACCGAGACTCAGC
CTGGAACATTACCCTCAACGGTATGCCAGAAGGCGGTGAGTTTCTGGGCT
ACCTAGACACCTGGCTGCAAGCTCCTACGGGGGAAGAATGCCCAGTAGCC
GGCAAAGCCGCCTACTCACACGCAATCGTCCCCGACCACGACCGCAAGAC
CATAAAAGCTAGCCACTTTCGCACATCCCACACTCCGCTCCGCAGTCAGA
AGGACTTTATAAACGCCTATGCCTCCGCCCGCCGCATTTCCGAGGTTCTC
TCGCAAAAATCTGGCCTTGAAGTCTTCCCTTACTCCAAATTCTACATTTT
CTTTGACCAGTACTCTTCCATCGTCGGCCTCACAGAAGCACTCTTACTCG
CAGCTCTGGCATGCATATTCCTGGTCTCTTCTATATTACTTGGAAGCGCG
CAGACCGGATTAATAGTTAGTGCTACGGTGCTAATGATCGTGGTAGACAT
TTTGGGCATAATGGCTCTATGGGGCGTAAGCCTTAATGCAGTCAGTCTAG
TAAACCTGGTAATCTGCGTTGGTATCGGGGTTGAGTTTTGCTCGCATATC
GCCCGAGCCTTCATGTTTCCCAGCCGCAGTGCAGTCGACCGCGCTCGCGG
CTTCCGCGGGAAAGACGCCAGAGCACTCGGCGCTCTCACCAACGTCGGCG
GTTCCGTATTCTCCGGCATCACCGTAACAAAACTAATAGGCGTCTGCGTG
CTCGCATTCACCCGTTCAAAGATTTTCGAAATATACTACTTTAGGATGTG
GCTTGCTTTGGTCATTGTCGCCGCTACGCACGCGTTGGTATTCCTACCCG
TTGCACTGAGTTACCTCGGCGGCGAGGGATACGTCCCGGACGATAATTAC
GGTGGGCTAGAAGAAGACTTGAGAAGTCGGACGTATAGGAATCTCGTGCC
GGCAGATTATGGCGAGAGTTCTGAGGAGGACTAGTTGGTCTGCCCTGAAG
GAGCGCACGTAGGATGGTATGAACATGATAGATATGCAAGCATGGACGGG
TTGGGGACTTTGGGTGTTTTTTTCTTTCTTTCCTTCTCTTTTTCTTCCAT
AAACAAAGAGCATCTGGCACCCTTTTCTCCTTCCCTCTTCTTTCTTATTA
CTCATACTGGCTTGAGTACATATTTTGGTTTCTCACTTTTTTCCTCTTTT
ACCTTTTTAGCTAGGGTATTTGCTCTTTGGTTTTGTTGCGAGAGTCATAC
CTTGTCGTGTCATGTTCGTGAGGCTCGGTCTGGCACGGCGTGGCGTTGGT
TTGTATGGTATGGTATGGTATAGTATAGAAATTGAGGGTTTCCTTTCTTT
CTTACGCTCTTTACGGATGGATGGATGTGTATTGGTTGGTAGATTTCTTG
GTTTAAGTACTTTTACTGCGGGTGGGGGGAAAAGTGGCTAATAGATATTG
ATATTGATATTGG

Sequences in the Contig:

SY0AAA32YC17FM1 SY0AAA46YN11FM1 SY0AAB11YC23FM1
SY0AAB25YB18FM1 SY0AAB34YB02FM1 SY0AAB41YD13FM1
SY0AAC25YA24RM1 SY0AAC31YG19FM1 SY0AAC31YG19RM1