Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4384
Length(NT) : 795
Best Gene Model Blast : Link to GSTUMT00003407001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63555.1| Score: 202 E_value: 3e-14
KEGG Definition: ankyrin
Accession: aor:AO090020000360 Score: 202 E_value: 1e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4384
TTGGGTGGAGATTGACCTACGAACCGCCTACGATGCGTGTGTTTCTGCAA
TCAATAGCAATCCCGCGCCGCAGGACATTGAGAGCGTCCAAGAAGCCCGA
GAAAACTTCTTTCGGTGGGATCAGAGAATATCGACAATCCCCCAGGCGTA
TACCCGGCAGGCGATTGCCATCCTACGGAGTACAGAGATGTCATTGGCCG
ACAGTGAAATTGATTCGGTAGTTAGCGGCTTGAGGATCGCGACTGAGAAA
CTAGAAGAGCTCGTACAGAAGGGTTTCGACGATGAGGAACTCAGTTATAT
GCTGAGAGGGTTGAGGGTTTCCAACAGTTTAGTCGACGAGCACAGGAGAA
GACGCCAAGAAGAACCCTACATTCGTATCTACCGCCTCAGATTATATCCG
TGCGTTGGAAACGAGAACCCCTGGGAGCGCAGAGTGGATATTTGCGACGC
CCGGGTATACAAACTGGATATCTGTACCTTCGGAGGGGTCAGCGATCCTG
TGGATTAACGCACCAGATGGGCTCGGGAAGACTATTCTTGCAGCTAGAAT
TGTGCAGGAGTTATTTTCGAGTGGCGAGGCACCTGTTGCGTACTTTTTCT
CTTCGCATGAGGATTCGATTCGGAGAGTCACGACAAACATATTGCGATCG
TGGATAGATCAGTTACCTACCCCCGGCGAGGAAGGAGGAAAGGACGCCCA
AGGACTCTCCGAAGACAAAGTTGCCAGAGAAGATGATCTGTGGCGGATCC
TCAGCACTGCCCTGCACGGTGTCGGGAAATCTTATCTCGTACTTG

Sequences in the Contig:

SY0AAC31YG03FM1 SY0AAC3YK07FM1