Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4383
Length(NT) : 763
Best Gene Model Blast : Link to GSTUMT00004084001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_07247
Accession: ref|XP_001554110.1| Score: 783 E_value: 1e-81
KEGG Definition: hypothetical protein
Accession: fgr:FG06880.1 Score: 774 E_value: 7e-81
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1936 Score: 818 E_value: 3e-88
PFAM Definition: tRNA-synt_2b, tRNA synthetase class II core domain (G, H, P, S and T). Other tRNA synthetase sub-families are too dissimilar to be included. This domain is the core catalytic domain of tRNA synthetases and includes glycyl, histidyl, prolyl, seryl and threonyl tRNA synthetases..
Pfam Number: pfam00587 Score: 278 E_value: 1e-25
Swissprot: O43011|SYH_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4383
TTGGCGTAGGCTGGCAGCGCGTCACAGCATCGCGATGCCCCTCCATTACC
CCTCATCACCCCCCACCATCACCAAAACGCTCACCACACTACTCCTCCGG
CAACCCCTCTTGTTCCCGCTACCACGCACACTGCTTTTACTACCCAGACT
AGATCTCCGAGCGAAGATGAGTTACTCGGCAGGAAGCGAATTAGCTATGC
CACTGAAGGGAAAGGGAAAGGGAAAGGGAAAGGAGAAGGCCGGGAAGGAG
AAAAGAGGGTTCGAGTTGAAAGTTCCTAAAGGAACTAAGGACTGGGAGGG
TAAGGATATGGTTATTCGTGATAAGATATTTTCTACCATCACGGATGTGT
TTAAGCGTCATGGGGCGGTTACTATTGATACTCCTGTTTTCGAACTCCGC
GAAGTCCTCACGGGTAAATACGGCGAAGACTCTAAGCTAATCTACGACCT
TGCGGATCAGGGGGGGGAAATCTGCTCCCTGCGTTACGACCTGACTGTCC
CGTTCGCTCGCTGGCTCGCCATGAACCCTACTATCCAGAGCATTAAACGC
TACCACATCGCCAAGGTATACCGCCGTGATCAGCCCGCTATGACAAAAGG
CCGGATGAGGGAGTTCTACCAGTGTGATTTCGATATCGCCGGCACCTACG
ATCCTATGCTCCCTGATGCTGAGATCCTGAGGATAACTACGGAGATCTTG
GACAATCTCGACTTGGGGAATTATACTATCAAAATTAATCATCGGAAGAT
CCTCGATGGGTTG

Sequences in the Contig:

SY0AAA21YL19FM1 SY0AAB56YO11FM1 SY0AAC31YF02FM1
SY0AAC38YM21FM1 SY0AAD45YB18FM1 SY0AAD57YN19FM1