Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4382
Length(NT) : 2045
Best Gene Model Blast : Link to GSTUMT00005073001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_05903
Accession: ref|XP_001592981.1| Score: 886 E_value: 6e-93
KEGG Definition: hypothetical protein
Accession: fgr:FG01527.1 Score: 866 E_value: 6e-91
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1605 Score: 617 E_value: 2e-64
PFAM Definition: NIF, NLI interacting factor-like phosphatase. This family contains a number of NLI interacting factor isoforms and also an N-terminal regions of RNA polymerase II CTC phosphatase and FCP1 serine phosphatase. This region has been identified as the minimal phosphatase domain..
Pfam Number: pfam03031 Score: 593 E_value: 1e-61
Swissprot: Q07949|PSR2_YEAST
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0005515 = Molecular function: protein binding
GO:0009408 = Biological process: response to heat
GO:0009651 = Biological process: response to salt stress

Sequence:
>Contig4382
TTGGATCAACACCTGTGCCTCCTCCATCAACCTCGACTGCTGTCACCGCG
ACCGGCGACAATACGTCTACCACCAGTCGTAAGGGAAGGCGGAGAAGAGA
GGCGGGGAGTAATGGGAGTAGTTTGAACTCTGGTGAAGAAGGACGTCCTC
GCAAACAGGCTGGCGGTTTGGGGAAGTTTTTCGGATTTTTATGCTGCCGA
AGTGGCGCATCTGCGGAGGAAATGCAACCCGGTCCACGCAGGACTAATAA
GAGGCCTGGATCTGCATCTTCCCGCAAAGCAACTCCTGTCGGGAAAGAGC
ATGCACTTAAAACTTCAAAAGATAGCGGTGTTGCCGAATCTAGGGATGCA
GCGGATGCTGGGAAGCCTGGGGATGATGGCAATACAATCCGTTCCGAGAC
CACCAAGGGGGACCCGACATCTGCCGCATCTGTTGCGTTAAGCTCCGGAT
CCGAGGATGAGGATAAGATAAAGCGGGTGGATGGTGAAGTTCTTGTTGGG
GAGAAGATTGTTGTAAAAGATGACTCCACTGCCAAAGAAGGGGCGGGGGC
GGGGCAAAACAGTTCCTTGTTGTCCGGTAGCACACCAACTGTCACCATAC
AGGCGCCTACACCAACGGCGCCCCAAACCGAAAAAGACGAGCCCGATTTT
ACTACTTCCGACCCCCAGTCGTCGAAGGAGGCCGGCACCTCGACTTCAGA
GGATATTGAGATGCGCGATGCAGATGGTGAAGATTATGACGCTACCGGAA
AGAAGGGCTCGGAGCTCAAGATTCAGTTGCCACTTCCTCCACATTCCGAG
GAATCTGGTCGGGATAGTGAGAGTGATGACACACAGCAGAGGAGCTCGGA
TGGAGGTTATCCCCACGACCCCCGCGATGCCGCGTTAATACGTACACCGT
CGCTGGACGAGAGGCAGCAGTGGTTGCTACCTCCGCTAGCTCCCAGATTC
GAGGGAAAGAAGTGCTTGGTACTGGACTTGGACGAGACCCTGGTACATAG
TAGCTTCAAGGTCTTGCACCAAGCCGATTTTACTATTCCTGTAGACATCG
AGGGGAGTTTTCACAATGTCTATGTTATTAAGAGACCCGGTGTAGATGAG
TTCATGAAGAGAGTTGGTGAACTATACGAGGTCGTTGTATTTACAGCTTC
TGTCTCGAAGTATGGCGATCCGTTACTAGATCAGCTAGATATCCATCACG
TCGTCCATCATCGCCTTTTCAGGGATAGTTGCTTCAACAACCAGGGAAAT
TATGTGAAGGATCTATCCCAACTTGGCCGGGACCTTAAGGATACTATCAT
CATCGACAACTCCCCTACAAGTTACATCTTCCACCCACAACACGCCGTGC
CTATTAGCAGTTGGTTTTCCGATGCTCACGACAACGAGTTATTAGATCTC
ATCCCCGTTCTAGAGGATCTGTCGACACAAGACGTTCGGGATGTAACGCT
GGTCCTGGACGTATCCCTGTGACGATCCGTATAGGTGGCTCCTTGTGGTG
GCTTTCGATGTTATGGTGGATTTGCTTTTCTTGGTCTTTCTATTTTGAAA
ATGGGGTTTCTTGCATCAACACATGGTGAGATGCCGATAATTACGGCTGT
ACAACTGCGTGCACAATTTTTGGGGAGTATGTGATTGAAAAAGCGCAATC
ATTGGATGGAGCAGCTGCGGTAGGATGTCTACTCATACAAAAATGCTGGT
CGATGGGAAATGCTGTTGGGATCAGGAACTGAGGCGAGATTCCTTGGAAC
GTGATCTAAGGCCTTTTATTCCTTGCCACTGGCTTATTGTCCAGTATATC
TTTTTTTATGTTCTCGTTTTTGTCTTTTTTCCCTGATATTCCACGCCCAT
GGGCGTTGAATCTCATTCAGCTGGCTACTGCCGTGTTTCTTTTGTAATGC
TTCTCGCACACTACCCCTCTCCTATTATCTTATTGTTAACTCTGCATACT
GTATATGCTGTTTTTTATATCCTCCTTTCTTTTTTGTTCTCATCTTCCGC
CTCCATTATTTTTTCCTCCCTTTTATTTTCTGCTGATTCATTCTC

Sequences in the Contig:

SY0AAB30YN07FM1 SY0AAC18YB16FM1 SY0AAC31YF01FM1
SY0AAC48YL20FM1 SY0AAD23YM22FM1 SY0AAD27YJ21FM1
SY0AAD53YE08FM1 SY0AAD6YB03FM1