Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4381
Length(NT) : 710
Best Gene Model Blast : Link to GSTUMT00007636001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein HCAG_03776
Accession: ref|XP_001541678.1| Score: 581 E_value: 3e-58
KEGG Definition: hypothetical protein
Accession: ncr:NCU01502.1 Score: 555 E_value: 1e-55
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1272 Score: 672 E_value: 2e-71
PFAM Definition: No Hit Found
Swissprot: Q9P4X3|UTP7_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus

Sequence:
>Contig4381
TTGGCTCACAGGCAACTCAATGAGCAATACCCGAAATGTCCGCAGTCAAT
TCCCCCGAATCTTCGGCTCTCACACGAACAAAACGTCCCAGAAAAAATTC
TTCCACTACTAAAAAGGACTCCTCGAAAGCACTAGAACCCAGGTCCCGGG
AGGAGGAAAAGACCGCGCTGAAGCAGTATGGCCGTGGCGAAAGCATACCC
GTTCGCTCAGTGCGGGACAGGAAATTACGAGCCAATCTCAAGAAGATTGA
ACACAGATACAAGGATGCTGCGCTGAAGGCCAAAGATGCGGAGTTGCTGC
TTGGGGAGGAGCGGGGATATGTTGAGGCGGAGGGGATGGAGAGGACATAT
AAATTTAAGCAAGCGGATCTACGGAAGGCGGTGGATGTTGCGACTGCTCA
GAAGGGATTCGAATTGAAGCTACCTACGTTCGGCCCGTACTTTATGGACT
ACACTCGCAATGGGCGATATCTGCTCCTCGGTGGGACAAAGGGTCATGTC
GCATCATTCGACTGGCGGGAAGGAAAGCTGGGTTCGGAAATGCAATTGAA
AGAAACCGTTCGAGATGTCAAATGGCTTCACAACGAGCTCTTCTTCGCAG
CAGCCCAAAAAAGGTACACATACATCTACGACTCTCAAGGTGTCGAAATC
CACTGCTTGAAAAACCACATTGAAGTAACCAACATGGAATTCCTACCTTA
CCACTTTCTC

Sequences in the Contig:

SY0AAB15YG04FM1 SY0AAB42YK12FM1 SY0AAB8YF06FM1
SY0AAC31YE21FM1 SY0AAC58YM22FM1 SY0AAD16YM15FM1
SY0AAD40YA05FM1 SY0AAD53YL21FM1