Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4380
Length(NT) : 926
Best Gene Model Blast : Link to GSTUMT00008521001 E-value : 1e-66
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4380
AAAAACAAGCGCAAAATGGATCTGACGCGGATAATGGATAAAATTGCCGA
CCTCCTATCTTACCCTACAGAAAATAGAATAGAGCAGACAATTCCGAACC
ATGGCCAATTTCGAAAACCCGTACGAGCCAGCGGAGAAAGAAAAAATAGA
CAGAACACCCAGACCAAGCAGAAACAGTGTATAGATATGAGAAGGGGAGT
GGATAGAAAACACGAAAAGGTGCTTGGGAAATGTAGAGAATTGACATGGT
TGAAGGGCAAGTGAAAGTGGAAGAAAAAAATTATACAACAAAAACTAACA
AAGAAACAAAACCACTAACTTTTTGTATAAGAAGAAAACCCATTTGTCGT
GATCTCCTCAGTACTTTGCTGTTTTCCGCATTTGTCGTTAGAAACCGAAC
CCCATTTAATAAGCTAACGAGTAAGGCGCCCAGAAACGATGACCCATAGA
AACAGAACACCAAGCAAAGCAAACAGGGAAAAGATCTGGTGGTGGTGGTG
GTGGAGGCACTTGATACGGTTCCACCCTCCTCTTGAAAACCCCCTCCGTC
AAGACGTTTTTGTCCTGGAGCCGCGAGCTACGAGGAATCGCCACCGGGAA
TCCCACCCAGAAAGAAAAGGAGAAACAGGATCGAAGAAAGGAAACGCTAC
CACCCATACAAGGAAATTGATACAGAATTAAGGGAGGTGAACCCCCCCAA
AAAACAAATGAGCCGCGAATATCACGGGCAAAGTGAAAAAGATGAAGGGA
TGACAGACGCCGAATGTTGAGAACCAACAAATAGTGCTCATACTAAGCCA
ATCCCACTTTCGCCAGAACCAGCAACAGCTATGACCACCCCCTGGTGGTG
GAGCTGTTGCGGGATGGATAGAATGTGCTCGATGATACTTGAGGCCGTTG
AGATTCTTGTATCGTTTGCCGCCCAA

Sequences in the Contig:

SY0AAA24YJ23RM1 SY0AAA26YG20FM1 SY0AAC20YJ15RM1
SY0AAC27YJ10RM1 SY0AAC31YE17RM1