Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig438
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00003160001 E-value : 4e-23
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: TBP, Transcription factor TFIID (or TATA-binding protein, TBP)..
Pfam Number: pfam00352 Score: 105 E_value: 9e-06

Sequence:
>Contig438
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGTAAACATCATATCCCCG
TTTTGTCCATCACCTTGACAAGACCCGAAATATCGACTTCTACAACGACC
TGATCAGTGTTCGTTCTGCTTGAAGCGATCTCTCTACTCTTCTCAAATTC
ACTCCTTTTGTTCCTTTTCCACATCGCCACACGGTCACATCCGAGCGATT
AGTCAGCGTGGTGAGAGGCACTTGTCAGACATCGATCTTTCAACAATAGA
ATCCATCACCATCTCATCACCCTTCCCGTTCACGATTCGTCTATTGCAGA
TTAGAACGGCTACACTCTCTACAAGCCCCATATCACCTTTAGTAAAGTAG
GGGAGACATTTGGTTGTTCTTCTCCTCGACCAACCTCATTGCCCTAAACC
GCTTTTTCCTGATACCCCGCTCCGTCACCATTACATCAACTTACCCTCCC
GTCAACTCCACACATCCGAAGCCTTTTCCTCAACCATCCGCAACCTCATC
AACCGCTTCGTCCATCAAAAAACAACAACTTCCATTATCGATCTTAATCA
TGGCGGCTATTATTTCCCACCCCCACTGCACTCATTTTCGCATCCGGCAA
GATGGTTGTCACCGGTGCCAAATCTG

Sequences in the Contig:

SY0AAA24YB16FM1 SY0AAA39YG22FM1 SY0AAC54YA21FM1