Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4373
Length(NT) : 2535
Best Gene Model Blast : Link to GSTUMT00002521001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein CIMG_03576
Accession: ref|XP_001244135.1| Score: 1505 E_value: 1e-164
KEGG Definition: hypothetical protein
Accession: ang:An16g04100 Score: 1464 E_value: 1e-160
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1831 Score: 1063 E_value: 1e-116
PFAM Definition: Not1, CCR4-Not complex component, Not1. The Ccr4-Not complex is a global regulator of transcription that affects genes positively and negatively and is thought to regulate transcription factor TFIID..
Pfam Number: pfam04054 Score: 990 E_value: 1e-107
Swissprot: P87112|NOT1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006402 = Biological process: mRNA catabolic process
GO:0006354 = Biological process: RNA elongation
GO:0006352 = Biological process: transcription initiation

Sequence:
>Contig4373
TTGGCAAAGACCTACATGCGGAGCACCCACTTTTCCAGTTCATCGAAGCT
ATACTCAGCAATGCGTCCCTGGCACAACCTAATATGCCTCGCCTAAAAGA
CGCTATTTGTACAACTGTGGCTTCCTCGGTATGCCTCATTTTGTATACGG
ACACGCAGAATCAGATGGAGGTTGAGGTGCTCGGGTTTCTCCTGCAGAAA
GTTTGCGAGCTATCACCACTCACGGCAAAGGATGTCGTTATGTGGCTTTC
CCAAGGCCAGGACGATGAGCGGATGTTCAATGTCCCAGTCACAGTCATGC
TTCTAAAGACTCAACTTTTTGCGCTCACCCATCTTGATGCCACCATTGCC
AGGTCAATTAACGCGAGAAAGCCTGCAGCGTTGGAGTTTTTGTCACAGTT
GCTCAAAGAGACTGTCACTGGTCCAAATCCTCTTGCCCTAAGAGCCGATT
TTGCATCGTCACTCGACGCCGTAGGTGGCTGGCTCAAGCAAGATCCCACT
AACAAGGCGGCTCTTGAATTGGCTGGTGACTTTCAAGATTCAGACAGGGG
AAATCAAGATGTAGATCTCGAGGACCGCGAGAAGCGTGACCAAATTGAGT
ATATATTCGCTGAGTGGATATCTCTCTGCCAGTATCTCTTGACATCAGAG
AAGAATTACTCCTCCTTCATCATGCAGCTTCATCAGACCAAAGCTCTAGC
TGATACGGCGTCCTCTTGCGAATTTCTTCGAACTTGTATCGAGTTTTGCA
TTGCGGAGTACGAACAGTCAACCAGCACCAACCCGACAGCAGCAACTAAC
TGCTATATCCCTATTGACGCTCTTGCTAAGTTGGTCGTCCTCCTTGTAAA
GTACCAAGGGGAAGGCGATCAGAAGGGTCAAGCGGTCGACAAGGCAGACT
ATCTGAACAGCACTTTGGCCCTGATCGTTTTTGTCTTTAACCACCATCAC
GAGGCTCGCGGTGAGCACTTTTCACAAAAAGTGTTTTTCCGTTTCTTTTC
CAGTATGCTGTACGAATATCACCTGATCGAAAACCAGATGATGGGGTACC
ATGAGAGAATATTGGAGACCTTTGCGGAATGCTTTTTAACCATCCAACCG
GCCTTCTTTCCCATGTTCAGTTTCCACTGGATGACATTGGTTTGCCATCG
GTACTTCATGCCTAAGCTACTTAGGCTCGAGGGCGAGAAGGGCTGGCCGG
TATTTGCGAAGCTTCTGGAGACCCTTTTGGTGTATGTTGGCGCACCACTG
AAAGAACGCTCTATTCCACCAGTCGTAAAGCTACTTTATCGAGGGATTCT
CAGGGTCCTTTTGGTGCTACACCATGACTTTCCAGAATTCCTTGCTGAAT
GGCATTTCTCAATCTGCGAGGTCATCCCAGTTCATTGCACACAACTTCGC
AATTTGATATTGTCTGCCTATCCCTCCTCGCTCTCGGACCTCCCAGATCC
GTTCACAGCAGGATTGAAAGTTGATCGCCTGCCAGAAGTCAAAAAGGCTC
CCAGGATAAGTGGTGATGTGTTCAGACCTCTTATCGATAGTGGGATAAAG
CAGTTACTGGATTCGTGCCTTGGTTCCCCCGAAGGTTTGACGAACGCAGC
GATACAAAGAATTGTGGAAATGTTGGACACAGAGCCTAGAAAAGTGACTG
GGCTCGGATTCGCTACAATCACCGTAGACACCGCTATTATCAACAGTCTC
GTCTTATATCTCGGAATGGAGGCCATACGTGAGGCCACTGAAAAGGGAGG
CTCAACATTCCAGACGCAGAGCCCACATACCGCCTTGTTCTCAAAACTTG
CAAGTGACCTAAAGCCTCAGGCCAGATACTTTTTCTTGAGCGCGATCGCA
AATCACTTGCGCTACCCTAACAGCCACACCCACTACTTCAGTTATTTGTT
GCTTTACCTTTTCGGCCAGGTCCAGGGCAAAACCAACGAGTCTGATGTGA
GGCAGCAAATCACCCGCGTCTTGCTCGAAAGATTGATCGTCCATCGCCCT
CATCCCTGGGGATTGATAATTACACTTCTGGAGCTGCTTAAGAACCCAAC
CTACGACTTCTGGCAGCTGCCGTTCATCAAGACCGCACCTGAGATTGAGA
GGCTTTTCGGTGCTTTGTTCCAACACATTAATAATTCCCCCCTTCGTCAG
TGAACAAAAATAAAGCATTGTCACTTTCCCACTTTTACTCATTTCCTCGC
CTTCCATGGAATCTTGCATACCTTGTCCTTTTCTCATCTCCGGGGGCGCG
CTGAAGCTTTTCTTTTTTTTGTCTTGCCTTGTCTGTCACAACTGGTGGTT
TTTCAGGGGGGAAAAGCACAAAACAAAAGTTATGTTGGGGTATTTAGATC
GGGGTTTTTCTCTCTTTTCTTTCTTCATATTCATTCCCATGATTAGTTAG
CATCCTTACCTCTCCGCATTTCCCGTTCGATTTCTTTTTTTTACCTTCCC
TTTTTTCTTTGAGGAGGACGATGATAGAGACATGAACGGGATAGATTAGC
CTAGTCTAGTTTCAATTCCATCTTACCACCTTGCC

Sequences in the Contig:

SY0AAA35YK04FM1 SY0AAA63YB18FM1 SY0AAB29YD05FM1
SY0AAB41YE15FM1 SY0AAC26YM05RM1 SY0AAC31YB16FM1
SY0AAC31YJ04FM1 SY0AAC35YA11FM1 SY0AAC46YP22FM1
SY0AAD15YI09FM1 SY0AAD27YF21FM1