Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4372
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00004416001 E-value : 1e-173
Numbers of ESTs : 2

Blast Results:

Nr Definition: Pre-rRNA-processing protein ipi1
Accession: sp|Q4WCP8|IPI1_ASPFU Score: 253 E_value: 3e-20
KEGG Definition: hypothetical protein
Accession: ani:AN8668.2 Score: 253 E_value: 1e-20
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2149 Score: 268 E_value: 1e-24
PFAM Definition: No Hit Found
Swissprot: Q5ASR2|IPI1_EMENI

Sequence:
>Contig4372
TTGGGAGCAAGAACAACAGCGACAACAACAGCAACAACAGTAACGGACAC
AATGGGAGCCAGCGCGAAACGCAAGAGGGAAAAACATAAAGACTTTCAAA
AGCCAAAGTTAAAAGTTGGCAAGGCAAAGGCCAAAGCCGACAACTTTACC
AATACATCCTTCAAATCGAAGGCAATAACCCTCACAACCCAATCCCTGCA
CACCACTGCTCCGTCAACAACATACCTCTTCGCCCATCACATCTCCCTCC
TAACCCATCACAGCGCAACAACCCGGAAAGAATCCCTCTCGTACCTAAAA
GCTCATCTCCCCGCTGCTCTGTCCACCACCGCTTCCGGAACTCCCAATGC
AATCTCTAACCTCCCGACCACCTCCTCACTGGTCTCCTCCCTCCTCCCAC
TAATTCTCGACCCCTCCACCTCGGTCCGTGCCCAGCTCCTCGCACTCCTA
ACCCTCCTCCCACACACACTCTTAACCCTACACACGCGGAAGATCCTGCT
CTTCGTGAACTCTGCAATGACGCACATATCCCCCGACATCCGTGTGGACT
CTGCCAAATTCCTAGATTGGCTGTTGGGGGCTAGCCGCGAGGAGGTGTTC
TCAGCCGGGGGGTGGGGCGTGTGTCTTCGTGGGCTGTGCGGGTGTCTGGG
GTTTAATGGCGCTGCGAC

Sequences in the Contig:

SY0AAC31YB07FM1 SY0AAC57YO01FM1