Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4371
Length(NT) : 633
Best Gene Model Blast : Link to GSTUMT00002438001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_07654
Accession: ref|XP_001591029.1| Score: 279 E_value: 1e-40
KEGG Definition: hypothetical protein
Accession: ncr:NCU01177.1 Score: 238 E_value: 1e-40
KOG Definition:
Classification: [Lipid transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG1430 Score: 126 E_value: 4e-08
PFAM Definition: RmlD_sub_bind, RmlD substrate binding domain. L-rhanmose is a saccharide required for the virulence of some bacteria. Its precursor, dTDP-L-rhanmose, is synthesised by four different enzymes the final one of which is RmlD. The RmlD substrate binding domain is responsible for binding a sugar nucleotide..
Pfam Number: pfam04321 Score: 219 E_value: 6e-19
Swissprot: Q566L8|MAT2B_XENTR

Sequence:
>Contig4371
TTGGGTTTTTCCGCGAACCTCACTTGAACCCCTCCTCTGATATCCCTAAA
GAAAGCTGCTAATTGCGATAGCGACAACGAGAAGAGGGAAAAAATAATCT
GGGATCAGAATGTCTGAGAAAGTGGTTGTGGTTACTGGGGGGACGGGACA
GTTGGGAAGGCAGTGTGTTAAAGCCTTTGAAGGAGCTAAGTGGAAGACCA
TCGGGACTGGGTATTCCAGAGCAAATCCTCCAGCGATTTTGAAGGTGGAT
TTGGGGAATGCAGGTGAGGTCGCTGGGTTGTTGGAGGAGGTGAAGCCCAA
GGTGGTGGTTCACTGTGCCGCAGAACGCTTCCCGGACAAGTGCGACGCAG
ACCCCGAGGGAGTCAAACGCCTGAACGTTCAAGCATCAAACAGCCTCGCC
CAGGAATGGTGCAAATCGTGACATAATCCTAATCTACATATCCACCGACT
ACGTTTTCGACGGGAAACCCGGTGCAGCTCCGTACGAGGCTGATGCCGCG
ACTAATCCGGCTAACTTCTACGGAGAGACCAAGTTGGCTGGCGAACAAGC
AGTCCTAAGCGCATGGAGGAAGAGTGTGGTGTTTAGGATTCCAGTATTGT
ACGGTGAGGTTGAGGAGAGCAAGGAGAGTGCGG

Sequences in the Contig:

SY0AAA16YC17FM1 SY0AAA38YH06FM1 SY0AAC31YA22FM1