Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4370
Length(NT) : 1355
Best Gene Model Blast : Link to GSTUMT00004530001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56958.1| Score: 1724 E_value: 0.0
KEGG Definition: ribosomal protein S6 kinase and related proteins [EC:2.7.11.-]; K08286 protein-serine/threonine kinase
Accession: aor:AO090001000439 Score: 1724 E_value: 0.0
KOG Definition:
Classification: [General function prediction only, Signal transduction mechanisms].
Kog Number: KOG0598 Score: 1268 E_value: 1e-140
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 657 E_value: 3e-69
Swissprot: P11792|SCH9_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology
GO:0005634 = Cellular component: nucleus
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0001324 = Biological process: age-dependent response to oxidative stress during chronological cell aging
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0008361 = Biological process: regulation of cell size
GO:0047484 = Biological process: regulation of response to osmotic stress
GO:0043619 = Biological process: regulation of transcription from RNA polymerase II promoter in response to oxidative stress
GO:0001302 = Biological process: replicative cell aging

Sequence:
>Contig4370
TTGGGCTTGGTGAGCAATCAGAGATTGACGTGTCGATATATGACCGTTCA
AACCAAGAATGCTTTTTGGGCCATGTTCGAATGTGTCCTTTGGCTACTAG
GGAACAACAATCTGGTCTAGATAATTGGTTTGCTTTACAGCCCAGAACAC
ATCACGAGAGTGTTGCGGGAGAGATTCGATTGCAGATTAGCTTCGAGAGA
ATCTCTAAAAAGCATTATGGCCCTGATGATTTTGAAGTGCTACGGCTGAT
CGGTAAAGGAACTTTCGGTCAAGTCTACCAGGTCCGGAAAAAAGATACTA
AACGGATTTATGCTATGAAAGTCCTGTCCAAGAAAGTAATTGTTCAAAAG
AAGGAAGTGGCACACACGCTTGGTGAACGTAACATCCTTGTCAGGACCGC
GACTACCGATTCACCATTCATTGTTGGATTGAAGTTCTCGTTCCAAACGC
CTACCGATCTCTACTTAGTGACGGACTACATGTCTGGAGGGGAGCTGTTC
TGGCATTTGCAAAAGGAAGGCAGATTCAAGGAAGATCGTGCCAAGTTTTA
TATCGCGGAGCTTATTCTTGCGCTGGAACATCTGCACAACCATGACATCG
TTTACCGGGATTTGAAGCCAGAGAACATTCTACTTGATGCTAATGGCCAC
ATCGCACTTTGTGACTTTGGACTTTCGAAAGCGAACTTGTCTGCGAATGC
TACTACAAATACATTTTGTGGAACTACCGAGTACCTCGCTCCAGAAGTTC
TGCTGGACGAACTGGGGTATACTAAGATGGTTGATTTCTGGTCTCTGGGA
GTGCTGGTGTTCGAAATGTGTTGCGGGTGGAGTCCGTTCTATGCCGAGGA
TACCCAACAGATGTATAAGAACATCGCGTTCGGGAAGGTCCGCTTTCCAC
GGGATGCTCTCAGCCTTGAGGGTAGAAACTTTGTCAAAGGGCTTCTCAAT
CGAAACCCGAGACATCGTTTGGGGGCTACACTTGACGCGAAGGAACTTAA
GAGTCATCCTTTCTTCAATGACGTGGATTGGAACGAGCTTTTACGCAAAA
ACGTTATACCCCCTTTTAAACCGACGCTTAGCTCGGAAACCGATACATCA
AACTTTGATCCGGAGTTCACCAACGCTCCGATGTCTCAGTCATTGAATGC
ACGAGCTGCTGCGTTGGCTTCTGGAAATCTGGCAGCAAGTACCCCCCTTA
GCCCGGGGATGCAGGCTAATTTCAGAGGCTTTACTTTTGTGGATGAGAGT
AGCATTGATGATCACTTCTTAGGACGGGATGAGTTGGCGCGAATGGACGA
AGGCGAGGAGGATGGCGATTGGGACGAAAGACATGATAATAGGAGAAATA
ACGAC

Sequences in the Contig:

SY0AAA44YE08FM1 SY0AAC31YA15FM1 SY0AAC50YH06FM1
SY0AAD14YE01FM1 SY0AAD58YP01FM1