Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig437
Length(NT) : 577
Best Gene Model Blast : Link to GSTUMT00009860001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein UM04657.1
Accession: ref|XP_760804.1| Score: 850 E_value: 1e-89
KEGG Definition: hypothetical protein
Accession: uma:UM04657.1 Score: 850 E_value: 6e-90
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0732 Score: 884 E_value: 4e-96
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 478 E_value: 4e-49
Swissprot: O14114|YEJJ_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig437
TTGGGGAACTGGAAAGACTTTGATGGCAAGAGCTCTGGCCGCAAGCTGTA
GCACAGAAGCCAGAAAGGTTACATTTTATATGAGGAAGGGGGCAGATTGT
CTCAGCAAATGGGTGGGAGAGGCGGAACGTCAACTTAGATTGCTGTTTGA
AGAGGCTAAGAACAATCAACCGAGTATCATTTTCTTTGACGAAATTGATG
GACTGGCCCCGGTTAGGTCCTCAAAGCAGGACCAAATCCACGCGTCGATA
GTGTCAACCATGTTGGCGTTGATGGATGGCATGGATGGCAGAGGACAAGT
TGTTGTAATCGGCGCCACTAATAGACCTGATGCGGTGGATCCCGCACTTC
GTCGCCCTGGGCGTTTCGATCGAGAGTTCTATTTTCCTCTCCCTTCAGTT
GATGCACGGAAGTCTATCATCGACATCCATACCAAGGGATGGAGCCCAGC
TCTACCAGAGGCATTGAAGGAAGGGTTAGCCTTACAAACCAAAGGCTACG
GCGGCGCTGATCTAAGGTCACTGTGTACTGAAGCGGCGCTCAATGCTGTC
CAGCGAACATATCCACAGATCTATATG

Sequences in the Contig:

SY0AAA24YB02FM1 SY0AAA24YB02FM2