Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4368
Length(NT) : 1428
Best Gene Model Blast : Link to GSTUMT00000562001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213723.1| Score: 374 E_value: 9e-34
KEGG Definition: predicted protein
Accession: aor:AO090003000550 Score: 347 E_value: 6e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4368
TTGGGTATTCTTGCTGGGATTATGATATTTTTTTATTTTTTATTTTCCCC
TTCTTGCTCGCGCGGCTAACCGTTTTGTTTTCGATTACCCTTTCGTGGTT
GCAGTACGGGTCCCTCCTTCCCTCGCGCTCCCCCCCCCGCATTTTGCCAT
CTGTGTCGTCGCCGCCTTCGTCCTCCTCCTTCTCCCCCTTCTCCTCCTCC
TCTTCCTCATTTGTTCTCACACACTCCTGATCCAATAGATTGATTACCGG
GACAGCACAATACAATCCCATTCGGTTCGCTGCGATTTCTTACTTTTTGG
AGCTTTTTTTTTTGTTGGGCCTTTTCGCCTTCTTCCTTCCTCTCCTCCTC
CTTCAACCTCCGAAAACTTTTTTTCTTCATAAAAAAAAAAAATGGTCTAC
AATACTCGCCGAAAGTCCCTCTCGTTACCGTCGCTCGGGATTCATCTTCC
ACAGAGTTCGCGCTCTTCGCCTTCGTCGTCCACGACAAAGAGCGAGCCAC
CACAGAAGCGTGTGAAACGGGATCACTCGCCTCTGTCCGCTGGCGGCTAC
GACACTACCAGTCGCAACAACCTCCCACCCTCTCCGCCACCGGAATTTAG
GATTAGCCATGAGGGCATCAACGATGAGATTGTATCTGGGGTAGTGGACG
TCCTCGAACGGTCGGGGAATAGGCCGCATACTGTTAAAGAGTTGGCGGCG
GTGTTGGCGCCTGTTCTTGGAGTTGTGGAAAACTCGGCTAATCCCCACGC
AATAATTTCCTCTCGACTAAACACCTACCTCAAGCGTCCCTTCTCATCCT
CATCATCGGCATCGAGCCAATGCGTACTTTCGAAAGAACTAATAACCACT
CATCCGAAGCGCATATACTTCTACCTAAGTGCAATTCCTCACCAACCAAT
CCCAAACTCTCATCCTCCCCAACTTAGTGTCGTATCACCTACACCTGCCA
CCCCTTCAACGTCGGATACCGAGGACCCGGACGCCGAGGAAAACGAGGAC
CCCTGTCGCCGTCGCGAGATCTCCCCTAGCCCGGAAGTGGATCTGGATTT
TACGTCACACGAACTATCACCCCCATCACCCGTGCCCAGCGCGACGAGTG
GTACCACAGCTACAAGTACGAGCCTCTCGGGAGGTAAATCCGCCCTGTCA
TCCCCGCCGCTGGAAGGCGACGAACGAGAGTTCTCGCAATCGGCCATATA
CATCTGCCGACGAAGTGCCAGTCGCGAGACATCCAACCCACCCTCCTCCG
TCGCCGGGGAGAAGCGAAATAGGGGCGAGTACGAATCGGATGGTCATGGG
GAGCCCGGCGGGGACGGAATCCTGTTAGGATATTCGCACGCAGCGGTATC
CGGTGTTGTTGGAGGCGTAGTAACGGGTGTCGGAGTCCTGGATGCTTCCG
ACGGGCTGGCGCACGTGAAGCGGGAGGA

Sequences in the Contig:

SY0AAA31YD07FM1 SY0AAA36YM08FM1 SY0AAA49YL08FM1
SY0AAA56YK24FM1 SY0AAB33YF21FM1 SY0AAB56YK08FM1
SY0AAB9YJ08FM1 SY0AAC31YA01FM1 SY0AAC31YE06FM1
SY0AAC42YG22FM1 SY0AAC43YG22FM1 SY0AAC47YA16FM1
SY0AAC51YG07FM1 SY0AAC53YH15FM1 SY0AAD12YH12FM1
SY0AAD13YL02FM1 SY0AAD27YP22FM1