Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4367
Length(NT) : 688
Best Gene Model Blast : Link to GSTUMT00006086001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_02244
Accession: ref|XP_001559080.1| Score: 204 E_value: 1e-14
KEGG Definition: hypothetical protein
Accession: ani:AN6608.2 Score: 199 E_value: 3e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4367
TTGGCTTTGCCCCTCTTCATTCCAACCTATCTTCTTCTCCAACGATCGTT
TTAATCACACCTACAGCTATTCCAGCGAGATCGAGCGGGAAAGCCAATCC
AACCCTTTATCCTGCCTGAACGGATGTTCTTTACGAGCTTAGCTATCCCG
CTGCCCCCGTAAATATGGTGAATAGGAATCTGCCAGCCTACAAACCGATC
GAAGTTACTTTTCTCAGCGAGCAAAAGACTGACCTGGGAGAAGTGTCGTT
CTGGCGCAATAACCTTGTGATCTTCCCGCTGCCCAGCTCGGGTATCTCCA
AGGTTTGGAGGCTAACTACCTATTTTAGGTTGCCGCTTCAAAACGCCATA
ACCATCTATACATTGCCCTGAGGTCATCAATTCGTGTCTACAGCCCAGCA
TACCCAAATCAGATCATCCCGCCAAACCTCTCCTACATAACCCTCACCTC
CAGCTTTACCCCAACCGGACCCGGGTATATTGACCCCGCAGAACCTCATG
CGATCAACTCGCTCACAGTTGGAGACCTGGGGTTCGAGGAGGTTCTTGTG
AGCGCACACGACGATGGTGACGTCTGCGTGTGGTACACAAGAGACCTAAG
CAAATTGGCATTTCGATTGTCAGTGGGAGAGAGTGCTTGGGGCGTTGCAT
TGCACAAAGAGCGGAGGTTGATGGCTGTCAGTGCAAAC

Sequences in the Contig:

SY0AAC18YA21FM1 SY0AAC30YO15FM1