Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4366
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00011601001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: acetolactate synthase
Accession: ref|XP_001260823.1| Score: 880 E_value: 5e-93
KEGG Definition: thiamine pyrophosphate enzyme, putative [EC:4.1.-.-]; K01671
Accession: afm:AFUA_2G13620 Score: 880 E_value: 3e-93
KOG Definition:
Classification: [Amino acid transport and metabolism, Coenzyme transport and metabolism].
Kog Number: KOG1185 Score: 162 E_value: 3e-12
PFAM Definition: TPP_enzyme_N, Thiamine pyrophosphate enzyme, N-terminal TPP binding domain..
Pfam Number: pfam02776 Score: 198 E_value: 2e-16
Swissprot: Q04789|ILVX_BACSU

Sequence:
>Contig4366
TTGCCGTTCATTATCCATTGAAACAAAGCTCGTTTGCCCCCCCAAAACCA
GTTACTCAAGCTAAGCATGTACACCGCTTCGTTCGCCTTCTTCGAGGCGT
TATGGGAGGCGGGGGTCACACATTGCTTCGTGAACTTGGGATCTGATCAT
CCAAGTATTCTCGAGGCGATCGTAAAGGGAAAACGTGAGAGGCCACATAG
TTTTCCGGAGTTTCTTACTTGCCCAAATGAGATGGTTGCTTTGTCCGCAG
CTCACGGAATGGCACAAGTCACTGGAAAGCCCCAGGCTGTTATTGTGCAT
GTTGACGTAGGGACACAAGGTCTCGGAGCCGCTGTTCACAATGCTTCGTG
CAGCCGTGTTCCTGTCCTCATCTTTGCCGGTCTCTCGCCCTTTACACAGG
AGGGTGAAATGCGCGGTAGCAGGACAGAATTCATCCACTACATCCAGGAT
GTGCCGGATCAGAAGGCGATAGTAGCACAGTACTGCCGGTATTCCGCTGA
GATTAAAACTGGAAAAAACATCAAGCAGATGGTCAATCGCGCAATTTCCT
TTGCCATGTCTGATCCCAAAGGCCCTGTGTACCTTACTGCTGCTAGAGAG
GTGTTAGAAGAAGATATTGAACCTTATAGTCTCAATCAGGCTGTCTGGGA
TCCCATTAGCCCTACGGCACTCACAGA

Sequences in the Contig:

SY0AAC30YN23FM1 SY0AAC34YP02FM1 SY0AAC60YM21FM1
SY0AAD32YL19FM1 SY0AAD33YJ02FM1 SY0AAD42YP12FM1
SY0AAD49YK11FM1