Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4365
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00002665001 E-value : 2e-80
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4365
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGGCCAACTGGGAACAACTCTGCATCGCTCCCTGGCGATAAGA
GTAGCCTTGCAGTCCGGGTGGAGAGAACTGAGAGCCGGAAGAAACCCGTG
GAAGATCGGTGATGGGTCAGCCCAATCGAGAGGACATGTAGGGTTTATTA
TGATATAATGCTGTTAGGAAATGCGATCTGGTAGCAGAGGGGCGGGGAGA
GGTGTCCTAGGGTATTCGGAAAGCATTGCAGGTTGATGCTGATAAATCCC
GCAGCCTTCTTCGGGGTTGCCTGTCCTAGGCAATATACAAGGGCCATCCA
AGAAAAAGTGGTACGGAGCCGGGTATTGATGTTAATTCCGGTCAAAATCA
GTGGTCCGGGGAATCCAACCTGCCCGGGAGCATAAATATTCCATTTCTCA
ACAAGAGCATAGAAAGCAGTCTTCTTTTGATAGATGGATTAAATTTGAGT
CTACTCCTCACCCATCCCTCACCCATCAATTATATCCCTTAGAAGTTAAC
CGAGGCAATGGGAAATAGAGAACCATCCAGGGTAATGTCTCTCGGGTGTG
CCACTGATACCGAAACTTCAATCAAGCACCCTACAGTACCACTATTTATA
GTCTGACGC

Sequences in the Contig:

SY0AAA20YH08FM1 SY0AAC30YN16FM1 SY0AAC33YI24FM1