Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4364
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00008499001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: 3-hydroxybutyryl-CoA dehydrogenase
Accession: ref|XP_001537416.1| Score: 390 E_value: 6e-37
KEGG Definition: 3-hydroxybutyryl-CoA dehydrogenase, putative [EC:1.1.1.157]; K00074 3-hydroxybutyryl-CoA dehydrogenase
Accession: afm:AFUA_4G04410 Score: 381 E_value: 5e-37
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG2304 Score: 275 E_value: 2e-25
PFAM Definition: 3HCDH_N, 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain. This family also includes lambda crystallin..
Pfam Number: pfam02737 Score: 426 E_value: 8e-43
Swissprot: P45856|HBD_BACSU
Gene Ontology:
GO:0008691 = Molecular function: 3-hydroxybutyryl-CoA dehydrogenase activity

Sequence:
>Contig4364
TTGGGAATATCTCCACACATTTGGAGAGAAAAGAAAAAAGGAGAAGAAAA
GGACCACAAAAAATGCTCCGTTCCACAGTTTCGAGGACCCTCCGCGAGCC
ACTCTGCCGGCAGTTCTCCGTTTCAGCTGTAGTGGGCGAACACAATGTCA
ATAGGTTAGGAGTTATTGGTGCCGGACAGATGGTACGTTGGGAATTTCAA
TGGACTCGGAATAGCCCTCGTAGCTGCTCAGGATGCTCGAGTTCCGGTAA
CGTTAGTGGATAACTCGCCGGAGTCTATCCATAAGTCTATAACCTTCATG
GAAACGTTGCTGCAGAAGAGTGTCGACAAGGGCCGTTTGGCCAGTGATGA
TGCCCAAAAAATCAAGGATCGCGTTACCACGTCTACGCAGCTCTCATCTC
TCTCAGAATCCGATTTCGTTATCGAAGCTGTGCCTGAAATCCCCTCACTG
AAAACGAATATATTTTCCAAGCTAGCAGAGATCACACCTTCAAACGCAAT
CCTCGCGACAAACACCTCAAGTATCAGCATAACCAAAATCGCAGCAGCAG
CGAGGGGGGCCGAGCACCGGGTTCTGAGCACACACTTTATGAACCCAGTA
CCTGTTCAGAAAGGTGTCGAAATCATCACGGGCTTACAAACCTCTCCTGA
AACCCTCACCCGTGCCCTCAGCTTTGTAAAGGCCATGGG

Sequences in the Contig:

SY0AAC19YJ16FM1 SY0AAC30YN10FM1 SY0AAC42YD15FM1