Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4363
Length(NT) : 1906
Best Gene Model Blast : Link to GSTUMT00010178001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61206.1| Score: 1139 E_value: 1e-122
KEGG Definition: predicted protein
Accession: aor:AO090102000098 Score: 1139 E_value: 1e-122
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P46974|ZMS1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0045449 = Biological process: regulation of transcription

Sequence:
>Contig4363
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCTCTCGATCTCACCCTC
CACCATGAGCCACCACTTCCCACCATTCAACAACAATCACCAGTATAACG
CTGACAATCGTACATCTTCGGCCACTTCCTTGCATAGCAACGGTGGGTCA
TCCATGACCTCACTCTCTGCGGAATCCGTGACGGATGCTACTCGAGCAGC
ATTGCTGGCAACGCTCGCGCAGGCACCTAGTATTCTCAACGGCCAGGGCA
CTCAGACTTATCAGCCTCCCCGTGCTCATCAACGACGGTATTCAACATCT
ACACAGCCAGCACCAGGAACTACCAGTTTTCCCCCATTTGTCGGGAAGGC
TACCGGCCTGCCCGGCACTGCTGATCTCCAGCGATACGTCGGGGCCTACA
TCAAATATTTCCATCCACATCTTCCGTTCCTCCATATCCCGACCCTCAAT
TTCAACTCCCCGGCATTCACGAATAGTGTCAAGGGCGGTCAGCGTAGCAA
CGGGGTTATCGGGGGTGGTGGATGCCTCGTTTTATCCATTGCTGCAATCG
GCGCCCTCTACGAATTCGAGCAAAACATCGCCCGAGATATCTTCGAGTTA
TCCAAGAAGACAATTCAAATTTTCCTTGAAGATCGTAGAAAGGCTGATGT
CACTGCTGCTCTTAGCGGTCTCAATACTAATAGTGGAGGCGGCGGTGATA
GTGGGACCAATACTCCCGTTTGGCTTGTACAGGCTATGCTCTTGAACGTC
ATTTACGGATTGCAGTGTGGAGAGAAGAGTGCTTGTGAAACCGCTGTCAC
TCACTGTGCAGCATTGGTTAGTTTGGCCAGGACTGCTGGGTTGACTAGAC
AGCCTCATGTATCCACTACACAAACTTTCAAGCAAGAGGACGGAGACATT
CATATGGGTGACTTAGAATCCTATGGTGGCAGTGTGGGCAGCGATGGTTG
GGGCGGAATTAACATCAAGATGGAGCCTGATGAGAACGTAGAGTGGACGA
GCTGGGTCATTGCTGAGGAGCGGAAACGGACTTTATACGCCGTTCACTTT
TTGTCAAGCTTGCTTGTTGCGGCACACAACTTGTCTCCTGCCCTCATGAA
TAACGAGATCCGCTGCGACTTGCCGTGCGACGAGGAGCTTTGGTCGGCTG
GGACCGCTGCGGTATGGAAATCCCGTGGTGGTCTAGCCTTGGCATCACAA
AACTCGGTCAATTTCACAAGCGCTCTTACCGGGCTCTTATCTGCCGGTCA
GCAGACATATGGTTCCCCAGGCCAATTCCAAAATTTTACCAATGGTCAGC
AGGGCGGTGTTCCCCCGTATCCACCCTCCGGGATTATTCCAAGCACGTTT
GGATGCCTCGTCTTGATTTGCGCACTCCATGTCTATATTTGGGAAACGAG
ACAAAGACACAACTCTCGCCATTGGACGTCATCTGAGGCTGAGACAATGC
ACGCTCACATCGAGCCTGCTCTCAAGGCATGGCAAGCCGCCTGGTATAGC
AGCCCCCATCATAGCATTGAGAGACCCAATCCGTACGCGATGGGCCCCCT
GTCAGCGGATTGTATTCCTCTGCTTGACCTCGCTTACATCCGTTTGTTTG
TTGATCTTGGCAGAGCCAAAGAATTCTTTTGGGCTAGGGACTACGAAGCT
ATGGCCGAAGAGATTGCAAGAGGATGGGAGAATGCTCAGAACAACTCTCC
ATCGAGCGCTTCTTCTATCTCGGCGCATTCCGATTCGTCCTTCTCTGGTG
CAATTTCGCCCGCGTCATCTCCTGCTTCCCAGTCCCCATCACCCAGCCTA
CGGCCGATTAAGATCGAACCTGGAGTTGCCCCTCGATACTCCACAAGCAG
CAGTGGCATGAACATTGACTCTTCAAGTGCCTCTGCCAAGAGGGAAAGAC
ATCTTC

Sequences in the Contig:

SY0AAA11YH23FM1 SY0AAA12YE05FM1 SY0AAA27YM23FM1
SY0AAA37YI15FM1 SY0AAA42YC07FM1 SY0AAB51YF02FM1
SY0AAC30YM19FM1 SY0AAC30YP09FM1 SY0AAC7YC18FM1
SY0AAC9YA21FM1