Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4362
Length(NT) : 610
Best Gene Model Blast : Link to GSTUMT00004524001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: clathrin-coated vesiclec protein (Bud7), putative
Accession: ref|XP_001263183.1| Score: 585 E_value: 7e-59
KEGG Definition: clathrin-coated vesiclec protein (Bud7), putative
Accession: afm:AFUA_3G12800 Score: 585 E_value: 3e-59
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2076 Score: 125 E_value: 4e-08
PFAM Definition: ChAPs, ChAPs (Chs5p-Arf1p-binding proteins). ChAPs (Chs5p-Arf1p-binding proteins) are required for the export of specialised cargo from the Golgi. They physically interact with Chs3, Chs5 and the small GTPase Arf1, and they form also interactions with each other..
Pfam Number: pfam09295 Score: 726 E_value: 8e-78
Swissprot: P87317|YB2G_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0030140 = Cellular component: trans-Golgi network transport vesicle

Sequence:
>Contig4362
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTTTTTGAAAAACTTCGCT
CAAAGGAACCTGAGGTTGCTTCTCTTCTAGCACGTGTTTTGATTGACGCG
GATGAGGAGGTCAAGGCTGTGTCTCTGTTATGCGAGACCATCAAGCTATT
GCCGTTGGATAGCGGCCTTCTTGATGTTCAAGCGGCCTTCTGCATGAGCA
AAGGGCGATATGATCTCGCTTTGGAATGCGCCAAGAAGGCTGTTAACAGT
GCCCCAAGCGAATTCACCACTTGGGAACGGCTCGCTCAGGTATACCTGAA
GCTCGAGCAATATGAACTGGCTCTCCTCACCCTTAATTCTTGTCCAATGT
TCACCTATCAAGATCGTGACCACCCAAAAATGCCACAGCCAACCAAAATG
CATCTTCCTGTCCTCGCTGAGTCGGTCCTGGATGAGATGTCTGACGAGAG
TCACGACCCTAAACATGACAAGCTGGATGCAGCTTTGCTGAAGCTTCCAG
CTGCCAGCTTGAGGGGCACATTTGCCAAGGCATATAAACTCCTTACGGAA
ATTACTAGCCAGATTGGATGGGACATGCTCTTGAAATATAGAAGCAATGT
TTTTGTTATG

Sequences in the Contig:

SY0AAC30YK17FM1 SY0AAC46YI20FM1