Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4361
Length(NT) : 902
Best Gene Model Blast : Link to GSTUMT00012184001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 109 E_value: 6e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4361
TTGGGACAACACCTACGGCCACAATGCCACGACCAAACAAGCGAACCTTA
GCCTGTCGGCGAGCATCAGGGATTGGGCGTGCAAAGAGACTACGACAAGA
GAGAGTAGTTGGCGCACTAGCGCCCATAACTTCACAAGCAATGATCGCAA
CCAACACAGAGGACGAGGAAGAAGAAGTTGGACCATCAGCGCGTAGGAGA
GGAGAAGAGGAGGAGCACAGCGTTCCTGAGCAGGAGGAGGGGGAGGTGGA
GGTGGAGGTGGAGGTGGAGGAGGACAAAGATCGAGAGCAGGGAGATGCAG
AGCAGAATGGACATGAATTGGAAGCGCACGTCGGGGAAGCGGGAGGAGGA
CCGGAACTCTATTCTAGTTTCTCACCGCTGGCTTATCGGCCTACTCCCAT
TCAAACACCCATTCCAATACCTATGTCCCCACCGGCACCCACCGCAACCT
CACCAACAGCTCCCGTGGCCCCTGTAGCCCCCGTAGCACCAATCGAGAAC
CCAGCGCCCGATACACAAAACGGTGATGACCATGAGAATGGACATGAGCA
AGCTGAAGGAACTGAAGAGCCAACTGTCACACCATTTACGCCCGTCAACC
CCCTCAACAAACCCATTCCAATCCCGTCATCCAGTGCTGCGGCCGTCACA
AAAACTCCCTGTCGGCAGACCCTCTGGCGCCGCCGTAAGAGGGCAGAAGC
TGCTGCTGCGGCAGCCGCCGCAGTAGCCATCACCGCTGCTGCACCCGAAG
CACCTCCCCCACCGGATACCCCGCCCGCCATATCGCTCACGCATGCACAG
GAGCTGAATGCGGCGCTGGCTCTGGCCGAGGGCTGTTCCCCAGAATATCA
AACGTGAGATCCTACTGGCTGCGGCCAACGATATGGAGAAATTGCTCAAA
TC

Sequences in the Contig:

SY0AAC30YK13FM1 SY0AAD22YF23FM1