Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4360
Length(NT) : 1150
Best Gene Model Blast : Link to GSTUMT00000016001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_06960
Accession: ref|XP_001591514.1| Score: 680 E_value: 2e-69
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05219 Score: 649 E_value: 4e-66
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1581 Score: 623 E_value: 2e-65
PFAM Definition: UAA, UAA transporter family. This family includes transporters with a specificity for UDP-N-acetylglucosamine..
Pfam Number: pfam08449 Score: 519 E_value: 2e-53
Swissprot: Q6C4X5|HUT1_YARLI
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig4360
TTGGGTGGTAATAATATTTTTCTAACCCTCATGGCTCCTCCCCCGCCTTT
CTACTTTTACCTTCGTTTCTTATATTTTTGTTTCTATCAGCTAACACATA
GGTTATAGCTTCGATATTGGAGGTGTCTAAACCTTGACTCTCTTTCACAT
TATTTTTGTCCTTCCCTTTTCTTTTTTTTCTAAGGAAAAGCTCCTTTTTC
TGTCATTACTGCCTCGACACGATAATTTTGGCCATGGCGCGCCGAAAGAA
TCCCCCACCAGAGGATGCGAATGACCCGATTGTGGCCATCGCGGGATCTG
TTGCCCACAAGGCTGAGAGCTCAAAGGATCATGGAAGCTCTATTTTCCAA
TTAATTATCTGCGTTGGTGGAATTTATGCTTCATTCTTAACATGGGCCCT
CCTCCAAGAACGCATAACCACAACCCCCTATGGCGCCGACAAGAAGATCT
TCCGTTCCCCACTTGTTTTGAACACTGTGCAATCTCTCTTCGCAGCTCTA
ACTGGTTATGCCTACTTCTCTTACTCTTCCTCCCCCGGCCAGCCCTCCCA
CGTCTTCCCCAATTTCTCTATCTCCCTCCGTCTCTTGCTCGTAGCACTCA
CCCAATCCCTCGCTTCCCCCTTCGGCTACGCCTCTCTCCAACACATTGAC
TACATAACCTACATCTTGGCAAAATCATGCAAACTCCTCCCGGTGATGTT
CTTACACATAACTATCTTCAGACGCCGATACCCGCTATATAAATACGCCG
TGGTCTTCCTCGTCACGGCGGGTGTGGCAGTATTTACATTGTACCCGGCG
CACCCGAAAAAGATCAAGAAGAGCGCTTCTTCGAACGGAGAGAAGAAATT
CTACGGGATGTTGTTGCTAGGCGTGAATCTTTTGTTCGACGGCTTGACGA
ACACTATCCAGGACGACATCTTCTCCAGGACGCCAAAGGGGGCTGTCTCG
GGACCGCAGATGATGACGGCGTTGAACACGATTTCATCGGTGTTGACGAT
TGGTTTTTTGTTGCTTAATCCCTGGAGCACCGAGCTGAATGATGCGCTGG
CGTTCGTGAAGGAGCATCCGAAGGTTGGAATGGATATCATGGGTTTTGCG
GTCTGTGGTGGGTTGGGACAGGTCTTTATCTTCCACACTCTCTCCAGCTT

Sequences in the Contig:

SY0AAA12YP23FM1 SY0AAA52YG06FM1 SY0AAB39YJ01FM1
SY0AAB52YB13FM1 SY0AAB53YF06FM1 SY0AAC30YK09FM1
SY0AAC33YM06FM1 SY0AAD46YJ16FM1