Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig436
Length(NT) : 1574
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig436
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGAAAGAAACCAACAACTC
ACTCAGTATGATACCTCAACCTCAACCCCCCTCCCTCCCAGGGCTCCCCG
TACCCGATCCTAATACTCAAAAGCTCAAGCTCCGGTCCGTCCGAACTGAG
CATCTGCGGCAACGGATCCCAAACCGGCACTCTCCTCCCTCCACTCCTAC
CACCGCCAGTACCCGATAGCCCAGGCCCCACGGGGACCCTAACTCTTCCC
CCGTTCAGCATGACAGCTTTCCGATCCGATGCGATCCGATCCCGATTTCG
ATCGTGCGCGTCCCGGTCAGCGAGCCAGCGAGTGCGAACAGTTTGAGATG
ACGGCGGCGATTTCGGTCCAGCTCGACAACTCGAGTGTGCGATGTCGGTC
GGACCGATGGGGCGGCAATACTCGTGGGTGCGTGTGTCGCCTACCTACCT
ACCTATGATACCTACCTACCTACCTATCTACCTGCCTGCCTGCCTGCCTG
CCTGCCTACCAGTGCGCCTGTATGTACGGTATGCCTCTCCGCGTATGGTA
GTAGTAGCAGTATCTATCGCGAGTTTGGCGGTCGGTCGGTCGGGCGCAAG
TGCAGTGGCTGTAATGAAAAAAAATATATATAAAAATAAAAATGAAGAGA
ATTAAAAAAATAAAAAGGAAAATAGGGAGGGCCATGATTAATGCGAACGG
CGGTATGGTGACCGCATGTACGATTCTCAGGATTACAGCCTGATCGGTAT
GTATGTGAGGTGGGGCACCGTATGTACTATATGTGTGCAGGTCGCGAGAC
GGCTTTGGAGGGTATGCTATGGTTTGCTATGGCACGGGTATGTATGCAGT
GATGATACTCTGCTGTACTCGTACTTGTACTGTACAGCACAGTACAATGC
AGCGAGCGAGCGAGCGGGCGGGCTGTCTGCACTTCACTGGCACACCCAGA
GCTGCCATCGGAACGACGACGACAACAGTGTCTTTGGAAGGATGGTACCC
TATTGTATGTACTCGAGTATGCTAGAAGGTTGGGGGTTTGATGTGGGCCT
ATACAATTATGATATAATACTGTATCATACCCAGGGATTCCCTTTCCCCT
TCCCTTCCCTTCCCTGAACCCTCCCCCATCCACGGTCACCCACACACACT
ACCGTACCTCTCTCCAATGAGCAACGTGTTCCTGTAAGTGGGATGGGGGA
GGAGAAAAAACTAAAAAGCAAAGCAAACGTTCCGCAGATCGAAGAAGGAT
AAGGTCTGGATAATGTTTAATTTTTCCTTTGAAAGCAGGTGGGAGGGGAT
GTTCCCCATTCATTTGTTTTGTTGCCGCCCGATATATCGTAGTAAAAGCC
GATCTGGTGGAATTATGCTAGCTCATGACCTGGTGTGCCCGAGCGTGGGT
ACGATGGATAGGGCAGCCAACGAAGGTTCTGGGATGATGTCTTTATTAGT
GTCACTGCTTTCTTTCCTGCTTAGAGACTTATGGTGGACATAATTTCAAT
TGTGAAGGGAGTTCTGCTGAGAGGAGGCGGGTGAGTGGTAAACTCTGGTG
ATGAATGCCTAACTTGAACGCCAA

Sequences in the Contig:

SY0AAA24YA24FM1 SY0AAA24YA24FM2 SY0AAC24YL06FM1
SY0AAD29YK10FM1 SY0AAD48YE12FM1