Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4359
Length(NT) : 625
Best Gene Model Blast : Link to GSTUMT00001405001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211282.1| Score: 450 E_value: 3e-43
KEGG Definition: uncharacterized conserved protein, contains WD40 repeats
Accession: aor:AO090120000284 Score: 449 E_value: 2e-43
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2110 Score: 416 E_value: 9e-42
PFAM Definition: No Hit Found
Swissprot: Q0CW30|ATG18_ASPTN
Gene Ontology:
GO:0034045 = Cellular component: pre-autophagosomal structure membrane
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>Contig4359
TTGGCGTTGTTCATCTACCATGTCTTTCTCTGATTGACTGACTTGACACC
CACGAAAACTCAACCTCCCTCCTTCAGTAACTCCCCACAATACTATCACC
CCGGAACCAAGGCGATCATTCTACGGCCGGGTTCTTTTGCACGTGCATCG
CCATCGTTTCAGACAGGCCACAGCCTTCCCGATAAAAACCCCCGTTCCGA
CTCAACCTTCACCTCACCGGTACTTACCCTCCGCATAGTAACATCGACCA
CAGAAAGCTAACACTCGCTCATCAAAGCCATGAACTTTGTCACCTTCAAT
CAGGATTTCTCGTGCTTGGCTGTTGGCACCCACCATGGCTATCGAATATA
TAATTGTGATCCGTTTGGCAAGGTTTACGAACAAAAGGAGGGCGGGGATG
TCACCATAATCGAAATGCTCTTTAGCACGTCACTCGTCGCTCTTATTCTT
TCCCCCCGCCGGCTCGTCATAACAAACACAAAGCGGCAATCCACGATATG
CGAGCTCACCTTTCCAACATCTATATTGGCTGTCAAATTGAACCGAAAGC
GTTTGATAGTGGTATTAGAGGAGCAAATATATGTATATGACATCAGTAAC
ATGAAGTTACTGCACACGATTGAGA

Sequences in the Contig:

SY0AAC30YK05FM1 SY0AAC38YA02FM1 SY0AAD20YA19FM1