Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4358
Length(NT) : 678
Best Gene Model Blast : Link to GSTUMT00009730001 E-value : 1e-124
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_00996
Accession: ref|XP_001247225.1| Score: 216 E_value: 5e-16
KEGG Definition: small nucleolar ribonucleoprotein complex subunit, putative
Accession: afm:AFUA_2G05930 Score: 190 E_value: 3e-13
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2055 Score: 205 E_value: 3e-17
PFAM Definition: No Hit Found
Swissprot: P40362|UTP18_YEAST
Gene Ontology:
GO:0032040 = Cellular component: small subunit processome
GO:0005515 = Molecular function: protein binding
GO:0000480 = Biological process: endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
GO:0000447 = Biological process: endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
GO:0000472 = Biological process: endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Sequence:
>Contig4358
TTGGCGAGAGGGTAAGTCTGGACGGTGCGGAGGGTGCGGGGAGTAGTAGT
GATGAAGAGATGGGCAGGGTGGAAGAGGAAGATGGGGATTCAGATGCGGG
AGCAGACTTACAAGCGCTACAAGATGATGAGTTATTCTTTGTTGACGAGG
GGCCGTCCAGTACCGACGGAACCCCCACTAGGGATATTCCGGGCGTCGGT
TGTGACTCTTCGGAAGGAGAAGAAGACGGGGAGGAGGAGTGTCTTCCGGC
ATGGCAAAAATCCGACGACGAAATCCTTACCATCTCACTTGCTAATCGGG
GCTTGCTGCGTAAGCTTCGGGACACCGGGACTGAAGACCTCATCAGTGGG
AAGGAGTATTGACAGTTTGAGAAGATTTATCCGGTGCTCGAGTGGGCTGC
CGGTGGCTTGGACAGGAAGAGGGTAAGTCTGGACGGTGCGGAGGGTGCGG
GGAGTAGTAGTGATGAAGAGATGGGCAGGGTGGAAGAGGAAGGTGGGGAT
AGGGAAGCGGTGAGGTCTGCGCCCAGTCTCGGGGAGATCCTAAGGTGTAC
TACGAACTGGACACGCAAGGTTCCAGGGAGGCTGCGGCCGGAGAAGTTAG
CGATAGTGAGGTTGGCAGATGGGAATAGGATCGGTGGTAGTTTGTCAATG
ATATCAACCCTCAACTTCCACCCCCACC

Sequences in the Contig:

SY0AAC11YH07FM1 SY0AAC30YK01FM1 SY0AAC36YM11FM1
SY0AAC53YD02FM1