Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4357
Length(NT) : 688
Best Gene Model Blast : Link to GSTUMT00004349001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001585237.1| Score: 577 E_value: 7e-58
KEGG Definition: hypothetical protein
Accession: ncr:NCU08044.1 Score: 560 E_value: 4e-56
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1205 Score: 435 E_value: 6e-44
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 289 E_value: 6e-27
Swissprot: Q05016|YM71_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0016620 = Molecular function: oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor
GO:0005515 = Molecular function: protein binding
GO:0008152 = Biological process: metabolic process

Sequence:
>Contig4357
TTGGCAACCCACTCCTCTCCCCTAACAAATCAGCCGGTTTGTGTACACAT
TAGTCTACATAGACATCTCTCCCAACTTGCATGTTCTTCCCCCGCCTATT
CCGCACCCTCACCACATACGCTCGTGTTTTCTCCCTTCGGATGTCTCATT
CCGCAATGCCCGCTCGCCTAGCGGGTAAGATTGTCTTGATCACTGGTGCC
TCCTCTGGCATCGGTCGTTCAACCGCAATCGAGTTTTCTAGGACTTCCCC
TACAATAAAATTGATTGTTACTGCACGAAGGGAAGAAGCTTTGAAAGAGC
TTGCCGCAACAATTGAGAAGGAGAGTGTTGGAGCCACAAAGGTGCTGCCT
GCTCGTCTGGATGTCTCTGATCCAGCGGATGTGAAGGGATTTTTGGCCAG
GCTTCCCGAGGAGTGGAGAGAGGTGGACGTTTTGGTCAACAATGCGGGTC
TTGTTAAAGGTGTTGAAACAGTTGGGAGCATCGCAGAAGAGGACATTGAC
GTCATGTTCTCCACAAATGTCACTGGACTCGTCAACATGACCCAGCTCAT
CATTCCAGGCTTCAAATCTCGCAATCGCGGGGACATAATAAACGTCGGTT
CCATCGCTGGTAGGGAACCATACGCGGGTGGAAGTATCTATTGTGCAACC
AAGGCTGCCGTTCGCAGCTTCACTGATTCTCTGAGAAG

Sequences in the Contig:

SY0AAA34YA06FM1 SY0AAC14YK10FM1 SY0AAC30YJ17FM1
SY0AAC33YG06FM1