Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4356
Length(NT) : 1659
Best Gene Model Blast : Link to GSTUMT00002842001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_10532
Accession: ref|XP_001550973.1| Score: 673 E_value: 2e-68
KEGG Definition: hypothetical protein
Accession: ang:An12g01080 Score: 660 E_value: 3e-67
KOG Definition: No Hit Found
PFAM Definition: TRP, Transient receptor potential (TRP) ion channel. This family of proteins are transient receptor potential (TRP) ion channels. They are essential for cellular viability and are involved in cell growth and cell wall synthesis. The genes for these proteins are homologous to polycystic kidney disease related ion channel genes..
Pfam Number: pfam06011 Score: 160 E_value: 1e-11

Sequence:
>Contig4356
TTGGGTTGTCACAATGCCGACAGAATCACTGTTGTCGTCGCCATCGCCAT
CGCCATCGCCGTCTGATGCCCCCGCTACAAGATCGATAGAAATTTCACTT
TCCTCTCCATCCACTCTTGTTCTGCGTAAACGACGGCCAAAGCACACTTG
CCCGCCTTATCCATTACCCTTATACTGCGCCTTTTCTCGTTCACCCTCCA
CCTCCCACTCGCTCATGTTACTGCTCCTGGTCGTCCTTGCCCTGTTTGCG
GGCTCGGCACGTTCAGTGTTGATCAGTACATTTGATAATTGCTTAAGTGA
TGACGTAGTACGCTCACCGACCGATATACAATTCCACCCGTTGGTGGTTG
CAGCTGCGTTTGGTACGAAAGATAAGGACCTTTTACAGATTACCGTTTGG
GGCAACGTTACAGGGGATAACTCTTCGAATCCTAGGGGGAGGCATCGGAG
GGATTTGCGTGGGAGTGATGGGCATTTCCAACCCAGGGCGGGGGATTGGC
CTTGGCTGGAGGCACGCCAGGAGGTCGCGAATTCTCAAAACTTGAACGGA
AGCGCCGTTACCGGTCAGCCGGGGACTTTGAATTGGGGACTGGCCAACTT
TCAAAATCCTACGTTTGACAGCGATGTTCAGTATCGGAATTCGGGTCTGA
TTGTGCATTCGGATCAATCTTGGCCGAAGGCTACAACTCTCCAGCCCAAG
ATTCAGATAGCATCCTTTGACACGTCTGCTGGTGCAATCTTCTTATGTAC
AGTTACTGGGTTTCCCAATGCCCGAGCGCCGTGTCCCTTGAAAACAACCA
AGAATATGTCCAAGAGTGACGCGCATAATTTGACTGTCTTGATGAAGGAG
CTCCCCTCGTTTACATGGGAATACAATTTCACGTCTGGGTACAGCTTTGC
TAGCATTGACACGACATTCACTATTATTTCGGGCAACAGCGACAAGACCC
TATTTGGCTGCATTCATGTTGAAACTACTCCGATGCTGGGAAAGTCTAAT
GACGCAGCCCTGACATGGGTTCCCGCAGGAGTACTAGCTTTGGTTGCTCT
TGGGACCATTCTTGCGGCTATGTTGAATCCCTGGGTTGGGACTACTGATA
TCTTCAGGTGGAGCAGCAACTATGGAATGGATGAGGATATGATACGATTG
GTTACACCTGGGTTTGCCGATTGTCTCCAGTGGTTACAATTCTTCGTTCT
TACTGGGAGTTTAACGCTCAGCTATCCTGGCTTTTACCAGCCCGTTGTTT
CCAGAGTCGCTTGGAGTGCTTTGCTCTTCAATACTAGTTTCTTTTCTCAT
GACCCGATTAGTCAGCGGAGATGGGCTGGTGATGGCCTTTACGCCCTAGA
TGCCACCGCATATGGATTTGAGAGAGTAGCTCAAGCTGTTGGACTGCAGA
CGATTGATGATATATGGGTGTGCGTTATGGCATTCTTTGGTGTTGTGGCG
ATAGGGACAGTTGTCATGCCACAGCTATGGTTTGCTGGCAAGTGGATTGT
AAGGAAGGCTATGGGACACGAGGAAGGCGATTTGACGAACAAGAACTTGC
CGTTCACCTTTGGGATGCTGAACCGTATCACATATACTTATTTCCTCACC
CCGATTTTGGCTGCTTCCATCTTTGTACTTACTACCCCTGGCCGTGGCAG
CAATACTAT

Sequences in the Contig:

SY0AAA30YB02FM1 SY0AAA32YJ05FM1 SY0AAB18YN24FM1
SY0AAC30YJ16FM1