Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4354
Length(NT) : 814
Best Gene Model Blast : Link to GSTUMT00004442001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_05482
Accession: ref|XP_001594054.1| Score: 535 E_value: 8e-53
KEGG Definition: hypothetical protein
Accession: cne:CNM01980 Score: 520 E_value: 2e-51
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0920 Score: 632 E_value: 1e-66
PFAM Definition: DEAD, DEAD/DEAH box helicase. Members of this family include the DEAD and DEAH box helicases. Helicases are involved in unwinding nucleic acids. The DEAD box helicases are involved in various aspects of RNA metabolism, including nuclear transcription, pre mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression..
Pfam Number: pfam00270 Score: 142 E_value: 7e-10
Swissprot: Q68FK8|DHX9_XENLA

Sequence:
>Contig4354
TTGGTCAGTATCGGGCGAAAGTTTTGGATATTGTCAACAATAATGCTGTG
AGTATTATTGTAGGTGCAACTGGTAGTGGAAAAACTACCCAGGTGCCTCA
AATTTTGTTGGAGGAGGCGATCAAAAATGGGACGGGTGCGAACTGCAATA
TTATCTGCACCCAGCCTAGACGTATCGCTGCCACCTCCGTAGCTGCGCGA
GTAGCTGTAGAGCGAAACGAGCCGCTTCAGAAATCTATTGGTTACCAAGT
TCGATTTGATTCCAAATTACCTATTCCAGGTGGCAGTGTCACCTACTGCA
CTACGGGTATATTGCTGCAACAACTTCGCAACTCTGCAGATGAAGCCTTG
GACGGAATCACGCATCTTGTTATCGACGAGGTCCACGAACGCGATATACT
TATCGATTTTCTACTAATTATTCTTAAACGAGTCATGCATGACAGAATGA
AGAGAGGGTTGCCGGAGGTGAAGGTGGTATTAATGAGTGCTACCATGGAC
ACGGAACTTTTCGCAAGTTACTTCCAGTACAAGACCGCCGATGGCAGGCT
TGTCCCATGCCCTAATCTGAGCGTGCCGGGGCGTACATTCCCAGTAAAGG
AGGTCTATCTGGAAGAAATCCAGGACGCTTTGCGTAATACATATTCACCC
CACCAGCTTTCCCTACTTCGCGATGAAGATACTCGCCTGTATCTTGATGT
GGAGCAATCAATATCTAGAGACGTCTCCCGAGTTCCATCAAGAGTTCCGT
CAAGGGCTACATCTGCTCGAGGCGAAATGGAAGAAGATGGCGCTATTGAC
GCCACAATTAATTG

Sequences in the Contig:

SY0AAC30YI24FM1 SY0AAD32YP07FM1