Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4353
Length(NT) : 866
Best Gene Model Blast : Link to GSTUMT00003305001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215590.1| Score: 388 E_value: 1e-35
KEGG Definition: hypothetical protein
Accession: ang:An12g00850 Score: 386 E_value: 8e-36
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig4353
TTGGCAATAATCAATCGATAATATGGGTAACCTACTATCCAAAGCCCCTA
GCGAGGGCCATTCCTCGACTTATGACAACAATAACCATAGCCACAATAAC
CATATCAACGTTAACCATAGCAACAACATCACCATAAATCGCAGCACCAT
GGAGATTTATTACGATCATGAGGGCCTAAACTCCGAAATCTCGCAACTCC
TGTACACGTCTGAATACGAGTTGCACCGAGATCGAGTTCCAGCGCCGGTC
GAGGGAACATGCACCTGGATCACCGAGCATCCAAGGTACCAGGACTGGTT
TGAGGTGGGGAAATTAGGTCTCCTCTGGCTATCGGCAGATCCAGGTTGCG
GAAAGTCAGTCATCGCTTCGTTTCTTGTAGATCATCTGAAGGCTCAATAT
TCCTCTATCGTTTGTTATTTCTTCTTTAAGGACGACTGCCGGGAGCAGAG
GAGCGCAAAATTTGCTCTTTCCGCTTTATTACATCAGCTTTTTGCGCAGC
GAAACAGCCTCTGCGAATATGCTGAGGAAGCATTGGAGGCTAAGGGCAGG
GGTTTCACAGAGGATGTGGATACGTTGTGGGGTATTTTGGTTAAGGCTGT
GGCTGAGGGGGAGTTCGGCGGTGTGATCTGTGTGCTGGACGCCTTAGACG
AGTGCGAAAAAGTGAGTCGGGATCAGCTTATCCACAACATGGTTGCACTT
GGAAGATTACGGACTTCCGGAATACCTTTGAAATTCCTTGTTACAAGTCG
CCCGTACCTTGAGATCGAGGATGGACTTGGCTCACCCGAAACGACGACAC
GGCTGAGAGGGGAGGACGAGGTCATGGCTATTGCTGGTGACATCACCCTG
TCATCGATAATGGGAT

Sequences in the Contig:

SY0AAB21YJ24FM1 SY0AAC30YH21FM1 SY0AAD63YA22FM1