Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4352
Length(NT) : 898
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4352
TTGGGAAGAAGAAATGAACCATAGAACCTTTCCACTCCCCTTCGTTTCTT
CCCCCCCACCCACACATTTCGCAGCCCAAACCCCATCCATCATCACCCCC
TTGCCTGCTTCTAAGAAACTAGAAAACCAGTCCGTCAAATCACCCTAAAA
TATCCCAGAGCCGAAGGGAACGCGAGCCCGAGGGAAATCACCACATCACC
ACAACCTATCTCGACCTTCTCCACTATCCTTCTTCTTCCCCCCCTCCGGC
TCTTCCCTCTTGTCCCTTTCGCGGTCAAATTCCTTCCACCCCCCCCGCCT
CTTTCACGCCTACTCTTCTCAATTGTTGGACGTCTTTTGACAATTGTGTG
CTCGCCCATCTGACTTTTGTGCGCTCTCACCTTCATATTCCTCTTTTTTT
TCTTTTTTTCTTTCTTGCGCGAAAGGCTGAGCCCTACCTGCCCATCCTTC
TGCCTCACTATCTGCTGCCGCTCTTTGTTGTGTGTGTGTACTCCAAGTTC
CATCTGTACTCCAAGTTCCATCCCAGAGCCAACCCACTCTCCACCCTCTT
TTTTTTTTTCCCCCAAAACATTCGCTCCACGTAATTTCAACACTCGGGAC
AACTGGAGAGTAAAATCTTCCAGAAAGAAAATCTTTGATATCGACCTTCG
ATTCTTCCAAGGGAGAAAAATCTCATTCAACGGTTCGCTGCCTGCAACCC
GGAGTAAGGCTTATCACTTGTACATCTTTGAGATTCACAAACGCGCCATT
CCATTGCAAATCAGTTCTTCAACGCACGTTTTAATATTATTCTCACTAGT
CGTTACTTCTTCGACACATAGGTTTCCTTCGCTGCTCTCTTTGCCTGGTT
GTCATTATTAGGATTACGACGAGATGGGTTGTGGAATGAGCACCGAGG

Sequences in the Contig:

SY0AAB17YP23FM1 SY0AAB40YP21FM1 SY0AAC30YG16FM1
SY0AAC34YK17FM1 SY0AAC62YG04FM1 SY0AAD1YK05FM1
SY0AAD48YE01FM1