Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4351
Length(NT) : 824
Best Gene Model Blast : Link to GSTUMT00007952001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_06425
Accession: ref|XP_369910.1| Score: 578 E_value: 8e-58
KEGG Definition: hypothetical protein [EC:4.1.1.48 4.1.3.27 5.3.1.24]; K01609 indole-3-glycerol phosphate synthase; K01658 anthranilate synthase component II; K01817 phosphoribosylanthranilate isomerase
Accession: mgr:MGG_06425 Score: 578 E_value: 4e-58
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0026 Score: 519 E_value: 1e-53
PFAM Definition: GATase, Glutamine amidotransferase class-I..
Pfam Number: pfam00117 Score: 330 E_value: 1e-31
Swissprot: P00908|TRPG_NEUCR

Sequence:
>Contig4351
TTGGCCCGCCTCTCGGGAACAGAAGAAGGAAATTACCCGCACATCACCAC
CATCACCACCATCATCACCCCCAACACACTTTCTTTCTCTCAAGTGCTAC
AACCACCACCATTCCGACTTCCCCCTCTCCCTCTTCCTTCCCTCTCTAGT
GCACGGCAATCGTTTTTTTCCCATTCTCACCAGAATCTTTCAATCAACTC
TTGGTCCCATAGTACCGGTAGCTTTTTTTTCGCCTGTGACGTTACTAGCT
TGTCGGTGATTCACTACTACTCCCCCTACCATAAATTTAGACCTTCAGTT
GTTGTTAAACAGCTATTATTACCGCCTTACCCTCATCCATCACCTTCCAC
CTATTCAAAAATGTCTAATCCGGGTTCCGCTCAGCCGGCATTGTCGACCG
CATCGAATGTCATAATGATTGATAACTACGATTCCTTTACTTGGAACATT
TACCAATTTCTCACACTGGAAGGAGCTAAGGTTACCGTTTACAGAAACGA
TAAAATCACTTTACCTGAATTGATCGCTCTGAGTCCAACCCAGATTGTTA
TTAGCCCTGGCCCTGGCCACCCGATCACGGACTCAGGCGTCAGTATTGAG
TGTGTCAAGCATTTCGCTGGGAAAATACCCATTCTTGGAGTCTGCATGGG
CCAGCAAGCGATCTTCAGCGCTTTTGGTGGTACTGTCGATTATGCTGGGG
AAGTCGTGCATGGAAAAACATCGCTAATAAAACACGATACAAAGGGAATC
TACCGGAATATCCCGCAAGACATTGCGGTAACCCGATACCATTCTCTAGC
TGGAACCCATGCTACACTCCCAGC

Sequences in the Contig:

SY0AAC26YA10FM1 SY0AAC30YG15FM1 SY0AAC38YE01FM1
SY0AAC55YP16FM2 SY0AAC62YK05FM1