Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4350
Length(NT) : 1531
Best Gene Model Blast : Link to GSTUMT00008991001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: sodium transport ATPase
Accession: ref|XP_001246391.1| Score: 1814 E_value: 0.0
KEGG Definition: potassium/sodium P-type ATPase, putative [EC:3.6.3.7]; K01536 Na+-exporting ATPase
Accession: afm:AFUA_2G01320 Score: 1765 E_value: 0.0
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0202 Score: 1265 E_value: 1e-139
PFAM Definition: Cation_ATPase_C, Cation transporting ATPase, C-terminus. Members of this families are involved in Na+/K+, H+/K+, Ca++ and Mg++ transport..
Pfam Number: pfam00689 Score: 318 E_value: 6e-30
Swissprot: P22189|ATC3_SCHPO
Gene Ontology:
GO:0005388 = Molecular function: calcium-transporting ATPase activity
GO:0006816 = Biological process: calcium ion transport
GO:0006874 = Biological process: cellular calcium ion homeostasis

Sequence:
>Contig4350
TTGGCTTGGCTGAACATCCTTTCGACTCTACCGTTAAACGCATGACAGTT
ATCTATAAGAATATACACACCAACACCGTCGAGGCATTTATGAAGGGAGC
CGGGGAAGTCGTTATTCCAAATCTCAACATCCCAGGGGAGGAGAAAGAAG
AAATCTTGAACAGAATTGAACGCCTTGCTGGGGAGGGACTTCGTGTCCTT
TGCGTGGCGCAGAAGACTCTTCCCTCTAGTGCAACGTGCGATACCGGCAA
CCGTGCCGCCGTGGAATCACAGATGAACTTCCTTGGGTTGGTTGGCCTCT
ACGACCCGCCGAGATTGGAAACTTTCGAGGCCGTCCGCAAGTGTAAGGTT
GCAGGTGTCAAAGTCCACATGTTAACCGGAGATCATATTCGAACAGCGGC
GGCGATCGCCCATGAGGTCGGAATCATTTCTCCTGCTATGCCTGCCGCCC
AGGCCGCTACCATGGTTATGACTGCTGGCCAATTTGATGCCCTTAGCGAA
GACGAGATTGATAAGCTAGAGGCTTTGCCTTTGGTAATCGCTCGTTGCTC
CCCAACCACCAAAGTCAGAATGGTTGAAGCTTTGCATAGGCGCGGTGCCT
TCTGTGTTATGACTGGTGATGGTGTCAATGATTCTCCTGCGCTCAAGCGG
GCTGATGTCGGAATTGCAATGGGTCTCAGTGGCAGCGATGTCGCCAAAGA
CGCTAGTGATCTCGTTTTAACTGATGATAACTTTGCCAGTATCGTTCGCG
CAGTTGAGGAAGGCAGAAGGTTGTTTGATAACATCCAAAAGTTTATCATG
CATCTTCTCATTTCGAATATCTCGCAAGTTGTCTTACTGTTGATTGGTCT
CGCTTTCGCGGACAGAAACGGTGTTTCCGTATTTCCTCTCAGTCCTTTGG
AGATTTTGTGGGTCAACATGATCACCAGCTCCTTCTTGGCATTAGGACTT
GGGCTTGAGGAAGCTCAGCCCGATATCATGCTACGACCCCCTCATGATCT
GAGGCAGGGTGTTTTCACCTGGGAGGTTATCATCGATAAGATGATTTATG
GTATCACCATGGGAACCCTCTGCCTTATAAGTTTTATTATTGTCGCTTAC
GGGCACGGCGACGGTGATCTCGGTTACGACTGTAACCATGCCTACAACAG
CTCTTGCGGCAACGTCTTCCGTGCGCGCGCTACCGTATTTGCTGTATTGT
CCTTCCTCTTACTCCTTACAGCTTGGGAAGTCAAGCATTTTTCCCGCTCC
TTGTTCAACCTCGACCCTGCCCGCCATAAAGGACCTCTCAGCATTTTCCA
CACTCTCTGGTATAACCAGTTCTTGTTTTGGGCTGTCTTTGCCGGCTTCA
CCATCACCTTCCCTGTCATCTATATTCCAACTTTCAACACTGCCGTCTTC
AAGCACATGGCCATCACTTGGGAATGGGGTGTTGTTCTTGGCTGCTCAGT
TGCTTATTTGTTGGTTGTGGAGAGTTGGAAGGGGATCAAGAGGTGGAGGG
GTATAGGTAGTGGCGTATTTGCCGGCAGGAC

Sequences in the Contig:

SY0AAC12YI09FM1 SY0AAC1YA10FM1 SY0AAC30YG11FM1
SY0AAD29YM13FM1 SY0AAD45YK11FM1