Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig435
Length(NT) : 766
Best Gene Model Blast : Link to GSTUMT00004729001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57966.1| Score: 257 E_value: 1e-20
KEGG Definition: RNA polymerase III transcription factor TFIIIC
Accession: aor:AO090003000835 Score: 257 E_value: 6e-21
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2076 Score: 174 E_value: 1e-13
PFAM Definition: No Hit Found
Swissprot: O74458|SFC4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0000127 = Cellular component: transcription factor TFIIIC complex
GO:0043035 = Molecular function: chromatin insulator sequence binding
GO:0006384 = Biological process: transcription initiation from RNA polymerase III promoter

Sequence:
>Contig435
TTGGACTTTAATGAAGCAATCTCTTACTACTCAGTAGTAGTAGAGGGCGC
CGTATATCTCGACCGCAAACTCTGGTTCAACATGGCAGACTGCTACAAAG
GCCTCGACAACATTGAAGATGCCGAAGATTGCTATGGCACCGTCTTAGAG
GCGTATCCAAGAGACGATGAGGCAATGATGCAGATGGCCGGAATCTATGA
GGTTACGGGTCGAAAGGCGGACGCCCTAGACCTTGTTAATCAGATAATCG
GCATGCGCCGAGAAAAGGAGAAAGCGGAGAAAGCTATGAAAGTCGTTACG
GCGACTGCTCAGCAGACAGAGGAAGCAGAATCGTTAGCGTTCTTCCCAAA
TCAACCCATTCCCGAGAGGGTTAAGCGAAAGAGAACGGGCATTCTCGGCG
AGGCGGAGAAGATGGAGATGAACGCGAAGAGGACGGAGCAAACGGAGATT
CGGTATAGGAAGTTGGAGTACTTGCGATCGAGTATGGAGGCTGGTGATCC
AGAAGCTGTGAAGCAATGGCTGGATACAGCAGGAGACCTGGTCGATGATT
TCCGCAATACAAGGGCATTATACCCTCATGAGAGGAGAAACAAATTTAAA
GGCTTCATGACGACTGCGCAGCGAAGAGCACTGGCTCTAGGTGAAACAAG
ACGAATTGAGAAGATGCAGGACCGTCTCAAACAGTCTTTAACTTTTGAAG
AAGAAGAAATCGAAGAACCGGAGCATCTATCAAAGTTCCGTGGGCTGGAC
TTCGACACGTGGCTCT

Sequences in the Contig:

SY0AAA24YA22FM2 SY0AAB20YM22FM1