Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4349
Length(NT) : 590
Best Gene Model Blast : Link to GSTUMT00007911001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_06991
Accession: ref|XP_001554403.1| Score: 475 E_value: 4e-46
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 416 E_value: 1e-39
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0508 Score: 263 E_value: 4e-24
PFAM Definition: Ank, Ankyrin repeat. There is no clear separation between noise and signal on the HMM search Ankyrin repeats generally consist of a beta, alpha, alpha, beta order of secondary structures. The repeats associate to form a higher order structure..
Pfam Number: pfam00023 Score: 109 E_value: 3e-06
Swissprot: Q6F6B3|TANC1_RAT

Sequence:
>Contig4349
TTGGGGGCATGAGGGAATAGTAAAGATGCTTTTGGAACGAGATGTCAATC
CCGACCAGCTAGACACCGAATATGGCGGGACGCCACTCTTATCGGCCGCT
GGGAATGGGCATGAGGGAATAGTAAAGATGCTTTTGGAACGAGATGTCAA
TCCTGAGCAGCCAGACACCGAATATGGCGTGACGCCACTCTTATCGGCCG
CTGGGAATGGGCATGAGGGAATAGTAAAGATGCTTTTGGAACGAGATGTC
AATCCTGAGCAGCCAGACACCGAATATGGCGTGACGCCACTCTTATCGGC
CGCTGTGAGCGGGCATGAGGGAATAGTAAAGATGCTTTTGGAACGAGATG
TCGATCCCGACCAGCCAGACACCAAATATGGCCGGACGCCACTCTCGTGG
GCCGCTATGAACGGGCATGAGGGAATGGTAAAGATGCTTTTGGAACGAGA
TGTCAATCCCGACCAGCCAGACACCAAATATGGCAGGACGCCACTCTCGT
GGGCCGCTCACCACGGGCGTGAAGGTGTAGTAAAGATGCTTCTAGAACGG
AAAGATGTCCACACCGATACGCCAGATAGCGAGAACCAAA

Sequences in the Contig:

SY0AAA16YK02FM1 SY0AAB39YD14FM1 SY0AAC30YG01FM1
SY0AAC58YC11FM1