Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4348
Length(NT) : 1093
Best Gene Model Blast : Link to GSTUMT00004994001 E-value : 3e-62
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4348
TTGGCTTTAAAATTCATGGCCCGGACTTGCCTTCAAGTCACCCATACCGC
CAAACCGAGAGCGGACTTGGCTCACGAGCAGCTACGATCCAGCTGAAGGG
GGAAGGCTAAACCAACGCTATTGCACTGCCCGTATTGTAGGCGATCGGAT
GTGGGCCTCCGCCTAATCTGCGGGAACCCTCGGGGCAGGGGTTTACTAGC
ATTTCCTCCATGGCACCCCGCGATCTAGCCGAAATTACACAATGTTTCTG
AATACAGTACCACTACGCTAGCACCCGATGAGTCCTGTGTTGGATGGGGA
TGTGGATGCGAATGTTCTTGTTTATTCTCAGGAATCAGGAGCGAGCCTGC
TAACTAAAAGGATTAACTAACAAGTGTACGGTACGCATCCATAGGTTTAC
CCTCAACACAGTCATACACTATCTCCAACATAGCTAGGGTCGTTTCCCAT
ACCCTACCGGTACATGCAACACTCAACATCCTGGGCATAGTTGTATGATA
GCAACTTCAAGACTTCTCATGCTCTAAGAAATAATGAAATCCGTCCTGTT
CGTGCGGATTATCGACTCCAAGATCCTCTTCGTTCATCAGACAACCACCG
AGTTCATGATCAACTTAGTGTTGCCCAGTCAAGTTTCTCCTATCTACCGG
TAGAATACTTCGGAAGCAGCCCCTTGGTGATGCATGCCGTCAGGCCTACT
CGAAGGGAGGCGGTCTTTAATCATGTACAAGAATATACCCCCCTCGATTA
TACAGCTAGCCGTTGGACAGGTCACTGGTGAGAACCGTAGGATAGAAATA
TGGATTACATCGAGTTCACGCAACTGATCGGCAAGGGCTGTTGTGCTGGT
GGATCGTAGTGTGAGGAGAGATCTGTTCGTTATTGTCTATCAATACAGGC
AAAGGAGGGAGAGGGAGAGACTATAGCTAAAAGTGGAAACACACACCCAC
ACACCTCACCCTACATATAGGGTTATCCAGACCTAACTCAAAGTGCTTTG
CAGAGATGTGGTGGAGATGAGATCGTTGTGTCATTCCCGACGAAAGGGGT
GGGGAGGAATCCAGCTATATAATTCTGTTATTCCTTGCTTGTT

Sequences in the Contig:

SY0AAB41YO19FM1 SY0AAB58YG21FM1 SY0AAC30YF17FM1
SY0AAD13YP08FM1