Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4347
Length(NT) : 1502
Best Gene Model Blast : Link to GSTUMT00000810001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein AN1768.2
Accession: ref|XP_659372.1| Score: 824 E_value: 6e-86
KEGG Definition: hypothetical protein
Accession: ani:AN1768.2 Score: 824 E_value: 3e-86
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1087 Score: 309 E_value: 7e-29
PFAM Definition: VHS, VHS domain. Domain present in VPS-27, Hrs and STAM..
Pfam Number: pfam00790 Score: 224 E_value: 5e-19
Swissprot: P87308|LSB5_SCHPO
Gene Ontology:
GO:0005938 = Cellular component: cell cortex

Sequence:
>Contig4347
TTGGAAAATCACCAACCATTTCCTCTCCATCATCACCATCATCACCATAC
CTTTGTGAGGAAGGGCTGCTGGAATCCACCTCCTTCGCTTGAAGATCCTC
TCTGGTCGAGGAAGTGTTTCTGTGCGCGGTTCATATTAGTATTGAGTTAC
CATACTCTACTAGCACTCTATCACAGCGACCTGAATCCGCACCCCTCCAC
CACACACTAGGATGTTTGGATCTTCCAGAAAACCCTTCTCAGCTGTAACG
GTACATATCGAGAGGCTCACCACCGAAGACTACGACGAAAACGATGTGAG
CGGTATTCCAGAACTTATCGAAGCTATAAAGCTTCAAGATTCTGGACCAA
GTGAGGCTAGTCGGGCCATCCGCAAGAAGCTCAAGTATGGCAATGTCCAC
CGTCAGCTCCGAGCCCTAACAATTCTCGATGCTCTTATTGGAAATGCTGG
TATCCGTTTCCAGCGCTCTTGTGCTGACGAGCCCCTTCTTGAGCGTCTTC
GAGTTGCTGCAACGGATACCATGACTGATCCAGATGTCAAAGCAAAGATC
AAGGTCCTTTTCGGGCAATGGGCACGTGAATATAAGGATACACAGGGACT
CACTGGAATTGCAAACCTTAATAAGCAACTTCCTCAGCGCAAGAGGGCGA
GACCTCAGCCCCAAGTTCTTCGTGAAACCAGTCCTGACCCCGAGAGGGCT
ACATCACCAGACCACCAGGCTTCTAGAAGTGGGCGCGCACCCACGTCCCC
CAAAGTTCCTACTTCGCCAAAACAATCACCTATCACCATTGGCCCGTCTG
CCGACCTTACTAGTTCCTCTAAAACACACAAGAAATCCAGCTCAAAAACA
AAGAACAAGGCATCCGAATTCAATCTTGAGAAAGAGAAACCTGCGCTTTT
ACAATCCCTCGCGAATTCCTCCGTTGCTTCCACAAACCTCAAAAACTCAT
TGAAGCTCATTAACAGAGAAAAGGACCGACCTTCCGAGAACGCCGAAGTT
CTCAAGAGGTTTGAGACATGCAGACAGCTTAGACGGAGCATTTTGAGATT
TATTCAGCATGTGGAGAGTGAACAGTGGCTTGGAGGTCTGATCCATGCTA
ACGAGGAGTTAGTTGAAGCGTTGACACTCTATGAAGTCCTCAATAAGCCC
ATTGAGGAAGATTCTGATAGTGAAGAGGAGGACTGGAACTCCCCTCCAGA
TAGGAACATCGATGAGGTTAGTTCCGGCATGGGAAAGGTGCGGATGCGTG
GCCAAGGGGATGAGGACAGACCGCCATTACCCAATACACCTGTTAGCACC
AGTGCCAAGGGTAAAGGCACCGATTACTCGCACCCAAGCGAGCCGGAGGG
AGAGGAAGAGGAGGATCCAGATGACCCATTTGGGGATAATCAGTATCGCA
TGGAGGAGACTTCATCAACCGAACCTTCTGGACCGAAGTGGCGGGTGGTT
TAGGGCCAATCAGCGCCCCTACACCACGCTTTATTATTCTTGAGCACTTC
TC

Sequences in the Contig:

SY0AAA17YK03FM1 SY0AAA17YK18FM1 SY0AAA45YP14FM1
SY0AAB45YP04FM1 SY0AAC30YF01FM1 SY0AAD40YB03FM1
SY0AAD50YN20FM1