Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4346
Length(NT) : 924
Best Gene Model Blast : Link to GSTUMT00005271001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_00307
Accession: ref|XP_001598221.1| Score: 566 E_value: 7e-98
KEGG Definition: hypothetical protein [EC:4.-.-.-]; K06215 pyridoxine biosynthesis protein
Accession: ani:AN7725.2 Score: 544 E_value: 4e-95
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG1606 Score: 695 E_value: 6e-74
PFAM Definition: SOR_SNZ, SOR/SNZ family. Members of this family are enzymes involved in a new pathway of pyridoxine/pyridoxal 5-phosphate biosynthesis. This family was formerly known as UPF0019..
Pfam Number: pfam01680 Score: 561 E_value: 3e-58
Swissprot: Q9UW83|PDX1_EMENI

Sequence:
>Contig4346
TTGGCTTCTTCGCCCTTTTCTCCCTCTTCCCCATCTACCAATCTTCACAG
ACGCTAATAATCTACTCTTACGCCTTTTGTCTCAAGGCTAATTAACCTTT
AACTAATATGTCTACCGCATTGCCCGTTAATGGTAATCACGAGCGTAGTG
CTCCATCAACCGACTTTACTGTCAAGACTGGCCTTGCTCGTATGCTCAAA
GGAGGTGTCATCATGGACGTTGTTAATGCAGAGCAGGCGAGAATTGCTGA
GGAAGCTGGTGCCTGCGCTGTTATGGCACTCGAACGTGTCCCCGCTGATA
TTAGAGTCCAAGGTGGTGTTGCCAGAATGTCCGACCCCAAGCTTATAAAG
GAGATTATGGAGGCTGTCACCATTCCTGTCATGGCAAAGGCGAGAATTGG
TCACTTTGTTGAGTGCCAGGTATGTTTTGGGGGCAGAGAGTTTCCAACAC
TCAAGGGCTGTTTTACTCATTTAACATCTAGATTCTGGAGGCTTTGGGTG
TGGATTACATTGACGAATCTGAAGTTTTGACACCCGCCGATAATACCCAC
CATGTTGTTAAGCATGGCTTCAAGGTTCCCTTCGTCTGTGGGTGCAGGAA
CCTTGGCGAGGCCCTTCGTAGAATCAGCGAAGGCGCTGCTATGATCCGTA
CCAAGGGTGAAGCAGGAACTGGCGATGTTGTTGAGGCAGTTAAGCACATG
CGCACCGTCACTGCCGAGATTCGCAGAGCTGTTCTGATGTCCGACGATGA
ACTTTATGTTTACGCGAAGGAAATCGGTGCGCCATTCGATCTCCTCAAGG
AAACTGCTAAACTCGGCCGTCTTCCCGTGGTTAACTTTGCTGCTGGAGGT
GTCGCCACCCCTGCTGACGCCGCACTTATGATGCAATTGGGATGCGACGG
TGTCTTTGTCGGCAGCGGAATTTT

Sequences in the Contig:

SY0AAA5YE23FM1 SY0AAC30YE23FM1 SY0AAC45YP11FM1
SY0AAD2YP15FM1 SY0AAD34YK20FM1 SY0AAD46YA11FM1
SY0AAD59YN08FM1