Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4345
Length(NT) : 2118
Best Gene Model Blast : Link to GSTUMT00007993001 E-value : 0.0
Numbers of ESTs : 26

Blast Results:

Nr Definition: hypothetical protein SNOG_04623
Accession: ref|XP_001795037.1| Score: 1169 E_value: 1e-126
KEGG Definition: predicted protein
Accession: aor:AO090103000016 Score: 1079 E_value: 1e-115
KOG Definition: No Hit Found
PFAM Definition: LMBR1, LMBR1-like membrane protein. Members of this family are integral membrane proteins that are around 500 residues in length. LMBR1 is not involved in preaxial polydactyly, as originally thought. Vertebrate members of this family may play a role in limb development. A member of this family has been shown to be a lipocalin membrane receptor.
Pfam Number: pfam04791 Score: 177 E_value: 2e-13
Swissprot: Q9NUN5|LMBD1_HUMAN

Sequence:
>Contig4345
TTGGGGGGACAACTTTGTACAAAAAGTTGGGGGGACAACTTTGTACAAAA
AAGTCCCCTCTCTCTTACACCCTCCCTTCTCCGTTGTATAGTCCCATTCT
ACTCTCTTCCACTGTTTCTCCTTCAAGGGTATGAGACTCTGAGATACGCT
TCTTTGACTGTCTCAGCTTTCTTTATTGATACCGGTGCCGTGATAACGTG
TGTTGAAACACTGGTTCTAATTTCACCGCTGAGTGGCACCCCTTGCAACC
TTGGATTTCCTGACATTCCCTTTTTTCACCCCGAATCATGACCGTCGCGA
TCCCTCTCATCTGGATCACTGCAATCATCGTCCTCGCATTTACGGTGATC
GCTGCATCCGTCTTTGTTAAAATCTACCAAGATCGTCACGATCGCGACGC
TTTCGTGACCGTGGTCTGCGTTCTATCCCTCACCTCTCTCCTTGCGACCG
TTTGCCTTCTGCCTGTCGATATTGCTCTCGTCTCCGGTACCACAAACAAT
GCCACGGGCCTCAAGAAGGACTGGGCGGGTCCGGAAACTGTCGCGCATAT
TATTCTGGGCTTGAAGATTGTCTACTACCTACTCTATTCACTTGATGTGA
TTATGTGTCTTCTTGTCATCCCCTTTGCCTATTTCTGGTACGAGGAATGG
GATGTCGATGCTACCACGAGCGGAAGGATCAAGGGGGCTATGAAATATAG
CTTCTGCTTCCTCATGTTAGTAATAATTTTACTTGTGGTAGGATTCTTTC
TTCCTGTCGCACGGGAGACAAAGGGGCATTTGGACCTCGATTACTTCAAG
AAGTTGCTCCTGGAAAATCACGGAGAACGCGCGTTGACATTCATCACTGG
AACCTTGCTATGCCTCGGAATTGTTCCCTACGTTTTCTACACAGCTCCTG
GACTTGCCCTTACGCCCCAACTTCTCATTAGATCTATACGCGGTGCATCC
CTTCCATCAATCTCAGCTTCGGCGCACCAAGATTTGCTCTTGAATCGCGA
GAGGCAGAGGATTATCGAGGCAAGATACGCCGGCGGACCTAGCTCTAGGT
TTACCGCCAAAGATAGACGCGAGTTAGAAGGCCTACAGCGTGAAGAGAGA
AGTCTTGTGCGCAGACAGAGAGTTGCCGAAGAAGGTACCCATGGTACACG
GAAATGGCTTGGGAAGCTACAGGCTATTGGGAGGCCTTTCGAGATCCTCC
TTGGGATCTTGGTCCTTCTGTTGTCGATCTCGATATTCATCTCAATGTTG
ATGACCTCGATTGACAAATCCAAGAACTCTGTGTGTGGGAAAAGCTGCGG
ATACATACTTGCCAAGATGAACATCCCGAACCCTATCAATTGGCTGTTTG
TTGCTACTAGCAAAGTATTTCCCATCGACTATATCCTAGCTTTGATTCTT
GTCTTGGACCTATTTATTGCCAGCGTTGTAGGAACGGCATTCGTTGGAAT
CAGGTTCTTGTGGGTATCAATATTTCGGATCAGGCCTGGCCATACGAAGC
CACAAGGTCTGTTGATGGCAACAGTCATTTTAACCCTCACAGTTTTGGCT
GCCAATTACTCGATTACCATGATCATTGCCCCACAGTACGCCCACTACGG
TGGACAAAAGTTCTGCAATAAGACTATACTGGAAACTGGCGTCTACCGTG
ACTGCAGCAATAACAAGGAGTTCATTATTCCATGCTCCGAGACTGGGCCT
CAAGACATCTGCACACCAACTTTCGTCTCAACATTCCTTAACCGTGTCAC
GCTCAACTTTCCCTACTTTGGCGCATTCGCCTTCTGGTCGCAATTCGCTT
TCCTAGGTGTTTACCTCATCACCCTCCTTACAGGTCTTGTCAGGCCCCCG
AAATCTGGAAACAGGGAGGCCGAAGATGAAGATGCTGAGAATGACGAAGA
TGAGAGCCTTCTCACTGGTGCCGGCCGCAGAGTTAATGCTGCTTGGGAGG
ATATTAGAGGACAGACTGGCGAGCGCAGGAATTATGGCACCGATGCCAGA
GTTAGAGGTGGAGATGACGCATAATATACTTTCGTTTTGGGGACTAGAAT
GGGGTTTGCGAATTTTGGAGTCATATGGTTGGATAGGGTTTGTTTTTATT
TATTTTTCCGTCATAGTC

Sequences in the Contig:

SY0AAA10YN09FM1 SY0AAA14YC09FM1 SY0AAA18YH04FM1
SY0AAA54YG24FM1 SY0AAA63YF14FM1 SY0AAB27YF19FM1
SY0AAB33YK02FM1 SY0AAB3YP21FM1 SY0AAB40YF23FM1
SY0AAB45YP19FM1 SY0AAC30YE22FM1 SY0AAC36YC14FM1
SY0AAC48YB01FM1 SY0AAC51YD05FM1 SY0AAC56YH18FM1
SY0AAC61YJ07FM1 SY0AAC61YK09FM1 SY0AAD18YI20FM1
SY0AAD22YL17FM1 SY0AAD27YH22FM1 SY0AAD27YM05FM1
SY0AAD30YA13FM1 SY0AAD34YL15FM1 SY0AAD3YI20FM1
SY0AAD49YO06FM1 SY0AAD9YB18FM1