Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4343
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00010906001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: histone transcription regulator Hir1, putative
Accession: ref|XP_001269280.1| Score: 346 E_value: 2e-52
KEGG Definition: hypothetical protein
Accession: ani:AN1286.2 Score: 337 E_value: 2e-52
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Transcription].
Kog Number: KOG0973 Score: 129 E_value: 2e-08
PFAM Definition: Hira, TUP1-like enhancer of split. The Hira proteins are found in a range of eukaryotes and are implicated in the assembly of repressive chromatin. These proteins also contain pfam00400..
Pfam Number: pfam07569 Score: 250 E_value: 2e-22
Swissprot: Q0CQ54|HIR1_ASPTN

Sequence:
>Contig4343
TTGGCGAGCAATGTCCCTAATGCTGCAGGCGGTACCAGTGCTGCAGGCGC
ACAAGCTTCTTCCTCATCGGACGATTATACCTTTGAAGCTAGGAACCTCA
GGAACGCAGGGGAGCCAACACGCCTAACTCTCTCAAGGCACGGCCAGATT
CTCTGGATGGACTTTGTTCCTAAAGTTGCTTTACTTGTGACTGGGAATAG
TAATTTTTGGTCCGTAGCTTGTGAAGATGGAACCGTTCATGTCTTTACGC
CCGTTGGGAGGAGGTTATTGAGCCCGCTCATTCTCGAAGCTCAGCCATGT
TTCATGGGAGTGCAGAGGATGGTGGCTGATGTGCATAACCTCTATCGGGA
TGGCTTATGTTTGGAACCTCCAAACAATGAAAGCCCCCCATCCACCTGTA
TCTCTAGCACCTATTCTCGATTCCTCAAACACCTACCAGAAACAGGACAG
CCCTACCAAGGCTGAGGCGATAACCGAAGCTGGTGTGAACTCTGAAGGAA
CCTTAATAGTCTCCCTAACCAATGGGGATGGATTTGCCTACTCAAGTGAC
ATGTACACATGGCACAAACTCACGGAAGCCTGGTGGGCGATCGGATCGCA
ATACTGGGATTCCACGGGCGCCATGCGGCCT

Sequences in the Contig:

SY0AAA36YF10FM1 SY0AAC30YD11FM1