Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4342
Length(NT) : 1608
Best Gene Model Blast : Link to GSTUMT00009963001 E-value : 6e-61
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein SS1G_04409
Accession: ref|XP_001594602.1| Score: 221 E_value: 5e-16
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 112 E_value: 5e-06
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 131 E_value: 3e-08

Sequence:
>Contig4342
TTGGACTTGACCGTCCTTCCCTTCCCTTCCCACCTTCACCCTCTTTTATT
TCCTTTGGATCATCATCTCGTGCTGTGGTGAGCTTTCGGGTTTTCCTTTC
CCTTCCTTTAAAGTTTGTTTGATTTTCTTCTTGGTCCTCTTTTGCGCGGA
ATCAGCTCTCCCATTTCTGCCTCGCCCTCTGCCCTAGTCGACGACTACCT
CGAAGGACGTGCTCTTTGTCCCATTTTTTTTTTTTACTTTCTTTCTTCTA
CCAGATATACAGCAAACCCACTGGAACTCTTCGCCAGTTCCTTGAATTCC
TTCTTTTTTATTGTCGTTCGAGAGAGAGAAAAAAAAAAAAAACTCCCCTC
AAGGTCAACGAGCACCCTAATTTTAATTCGTCAACTTTCCGAAATCGCGC
AGCTACGAACCAGCCATATCTACGAAAATCACCTTCCTTTGGAATCCCAC
TTGACCACACTCACTAAACTACACACTCTTTCACAAAACGATACTCAGAA
TAATAACCGTGACGTTTACCTCCCACTATATACAACTTCACGAAGCACCT
CACTATATTATTATATATGCGCCTTTAGTAAAGACAACACTCGTAGTTTT
AAAGCAATACTTAATCCATTAGTTCTCAATTACAACTATAGCAACCTAAT
AATTACTACTACTACCACCACCTAACGGCAGCAGCACCGATAACAACGAC
AATAACAACAACAACCGCAACGATACCAGCAATGGAATCCTCATCCTTCT
TCTATTACACTCCAGACACCACTTCCCAGACAAAGCAGCATGGTCATTTC
CTGCCCCATCCCAATGGGCATTCCCAGCAACAGCAGCAGCAGTCAGCTTC
TCAGTGCGACCAGAACTTGACGAATTCGAGTGTACCGTACCCGTCCTCTT
TGGTGTACTCCAGGCCCACGTCATCCCATCTGAAGCCACCCACGTTACAA
GCACCGCCGACACCTCTTCTGGCCACGGGTACCTTATCCCCGGAAGCTCT
TCAGAAGCAGACCGGCCTTCCTACACCTTTATCTCCCACTCTTGGTATGG
ACGGGCACAGCGGCGGTGATATGTACTTCTTCCCTTCTACCCCGACACTC
TCATGCAACTCGGTCAACACTCCGCCAATGAGCACTGTCACCACTACACC
TTTAATCACTCCTTGGTCCTTGGATGATGGCTGCAATGGTACCATTACTC
CGTCAGATATCCAACTTCCTGACACTCCCGAGATATGGAGAGAGAGCCCT
CCCATGACTCCAGCATATATTTATCCTCCTAGTCTGCTCCCAACCCACTC
GAGCCCTTCGGTTCTCTTGCCGACTTGCCCCTCATTGTCACCAGCTTCGG
ATCACTCATCATCTCCGGAGCTCGATTTCTGTGATCCACGAAAGCTCACA
TATCCGTCACCCAATCCGTCCGCTTCTGACAAGGATTTGGAGTTTGCTAC
TCTTCCTTCCATTCGCGATGATGATGACGAACACAACTTCATGCTCGGTA
TGGGAAAGGACGATATTAAGACCGAGGGAAGGGATTTTGCCCACGGCTTC
CTTGGTCTCGAGGAGCAACTCTCTGACTTCGAGTCTGATAACGAGCTTGT
CTCCGGAT

Sequences in the Contig:

SY0AAA14YF12FM1 SY0AAA15YL20FM1 SY0AAA15YL21FM1
SY0AAA27YN04FM1 SY0AAA4YE04FM1 SY0AAA4YO11FM1
SY0AAA8YH24FM1 SY0AAB15YD08FM1 SY0AAB17YG07FM1
SY0AAB19YB04FM1 SY0AAB19YP07FM1 SY0AAB45YL23FM1
SY0AAB61YA18FM1 SY0AAC17YK08FM1 SY0AAC30YD08FM1
SY0AAC62YL21FM1 SY0AAD13YA11FM1 SY0AAD48YF12FM1