Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4341
Length(NT) : 2058
Best Gene Model Blast : Link to GSTUMT00009396001 E-value : 0.0
Numbers of ESTs : 45

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001244143.1| Score: 2184 E_value: 0.0
KEGG Definition: acetolactate synthase, large subunit, putative [EC:2.2.1.6]; K01652 acetolactate synthase large subunit
Accession: afm:AFUA_3G10310 Score: 2133 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism, Coenzyme transport and metabolism].
Kog Number: KOG4166 Score: 2021 E_value: 0.0
PFAM Definition: TPP_enzyme_N, Thiamine pyrophosphate enzyme, N-terminal TPP binding domain..
Pfam Number: pfam02776 Score: 624 E_value: 3e-65
Swissprot: P07342|ILVB_YEAST
Gene Ontology:
GO:0005948 = Cellular component: acetolactate synthase complex
GO:0005739 = Cellular component: mitochondrion
GO:0003984 = Molecular function: acetolactate synthase activity
GO:0050660 = Molecular function: FAD binding
GO:0009082 = Biological process: branched chain family amino acid biosynthetic process

Sequence:
>Contig4341
TCATTGTTCAACACGATGACCTTGACACCAATATTGAACTGCACAGCAGT
AGACAACTCAGTAAGAGTCATGTTAAAGCTGGCATCACCGTCAATATCGA
TAACAGTGGCTTCAGGTCTGGCAACTTTAGCCCCAATAGCAGCCGGGAGA
CCATATCCCATAGTTCCCAAACCACCAGAAGTAATCATTGTACGAGGGTG
CCTCCATCTGAAGTGCTGAGCAGTCCACATTTGATGCTGACCGACCCCAG
TAGAAATAACAACTTCCTCCTTCATGTGTGCAGTTTGCTTGTTGATCTCC
TCAATAACAGTCTGAGGCTTGATCATAGAGCCAGGAGTCTCTCTCTCAAA
GGCAAAGGGGTAGCGCTTTTTCCAGTCATTGATTTGTGCAAACCATTCTG
GACGTTCGGCCACTGAACTGACTCGGGGGATAAGGAGAGCAAGGTTTTCG
GCAACATCACCCTCAACAGCCTCGGTCGCTTGGACAACCTTGTTGATGTT
CTTGGGCATAATTTCAAAATGGACGATGCCTCCACGGCCCTCGGCACACG
CCAACTTGGCCTGTGGTGCGAATTTTGCGATATTTCCCGTGACACGATCA
TCAAATCTTGCCCCAAGAGCAATGATCAGGTCAGCCTCTTGCATCGACAA
ATTTGCATATGGAGACCCGTGCATGCCCAGCATGTGCAAGCTCTTCTCAT
CGAGCTCGTCAAAACCTCCCAGCCCCTGGAGGGTTGTGGTGACAGGAATC
TTTGCCTTGTCCGCAAACTCCTTCAACAACTTTGGCCCCTCCGGCCGCTC
AATCACACCTTGTCCGGCGTAGATGACAGGTTTCTTTGCCATGTTTACAA
GCTTAGCGACCCTCCCGACACTAGCATCAAGATACCTCCTCCTGGCCTCC
TTCGCAGCCAGGGAGGCAGCAGATGGATGAGAAGGCAAGTCACTTGCTAC
GGGGATGGCTTTCCGTAAAATACCGGCCGTGACATCCTTTGGCAAATCGA
CAAGGACAGGTCCTGGTCTGCCTGATGTGGCGATCTCGAAAGCCTCATTT
ATCCGACGTGGGAGCTCCGCGACATCCTTTATCATTACGTTCCACTTAGT
ACAGGCACGGGAGATTCCGACAACATCGGCTTCCTGGAAGGCATCGGTGC
CGATTGCGCTAGTAGGTACCTGGCCGCAAAAAACCACGAGAGGAGTTCCA
TCGCTAAGAGCGTCTTGGAGGGGGGTAACAACGTTGGTGGCCCCTGGGCC
AGATGTAACCAAGACAACACCTGGCTTACCCGAGGCACGTGCGTAACCCT
CAGCCATATGCCCCGCACCCTGTTCGTGGCGGGGCAAAATGAATTGAAAA
TGTTTTGACCGGTAAATAGCATCGAAAACAGGGAGGATGGCACCGCCAGG
ATATCCAAAGATATGCTTAACCCCATGTCGAAGCATCATTTCATGGAATA
TCTGACCACCCGACATCCCAACAAATGAATCGTCCATTTCCTGGCCATGT
TTGGGCTGGAGTGGGTGCGGCGCATGTGCTGCCGGAGGCGCTGTTGAGGG
AGGATCCTGATCGAAGGCTGGTGAAGGAATTGGTCTTGCCGATGCAGAGG
TAGATTGGTTTCGAGGAACATTTGGAATGACCTTACGAGCAGGGACAGCT
TGTTTGCGCAGATGGGGTGAGATAACCTTAGTTATGGGGGTTGTCGCAAA
GTTCCTGCCTGGGGACCATCGACAAAGAATCCTCAAAGGAGCCCTAGAAG
CGGATCGCAGCATGGCGTTTGCCAACCGGGGAAGGAAGAAATAATTAACT
CAAGAAAAAAGAAGGAAGGCGATGAGCGAATTGAAGTCTGAACTGAGCAG
AGATGGACGAACTACGGGGGGAAGAAGGGCCAACTTTTTTGTACAAAGTT
GTTTGGCCAACTTTTTTGTACAAAGTTGGCCAACTTTTTTGTACAAAGTT
GTCCCCCGGCCGCACAACTTTGTACAAGAAAGTTGGGTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTT

Sequences in the Contig:

SY0AAA10YK16FM1 SY0AAA30YP15FM1 SY0AAA41YE23FM1
SY0AAA41YH23FM1 SY0AAA43YN11FM1 SY0AAB11YC02FM1
SY0AAB13YL05FM1 SY0AAB27YM09FM1 SY0AAB37YE14FM1
SY0AAB40YK04FM1 SY0AAB48YB16FM1 SY0AAB49YD13FM1
SY0AAB60YO11FM1 SY0AAC13YI05FM1 SY0AAC19YM16FM1
SY0AAC20YD02FM1 SY0AAC20YG05FM1 SY0AAC25YM11FM1
SY0AAC30YC19FM1 SY0AAC36YL03FM1 SY0AAC37YH07FM1
SY0AAC41YD01FM1 SY0AAC45YA05FM1 SY0AAC48YP21FM1
SY0AAC50YD07FM1 SY0AAC55YJ15FM2 SY0AAC56YG17FM1
SY0AAC59YJ12FM1 SY0AAC59YJ21FM1 SY0AAC61YC02FM1
SY0AAD10YO24FM1 SY0AAD13YG15FM1 SY0AAD18YB03FM1
SY0AAD26YC12FM1 SY0AAD27YJ18FM1 SY0AAD27YK02FM1
SY0AAD31YA02FM1 SY0AAD33YH14FM1 SY0AAD38YB20FM1
SY0AAD47YB09FM1 SY0AAD48YC14FM1 SY0AAD49YI06FM1
SY0AAD52YO11FM1 SY0AAD58YI14FM1 SY0AAD60YI14FM1