Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig434
Length(NT) : 1337
Best Gene Model Blast : Link to GSTUMT00003308001 E-value : 0.0
Numbers of ESTs : 45

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59069.1| Score: 925 E_value: 1e-97
KEGG Definition: probable taurine catabolism dioxygenase
Accession: aor:AO090023000531 Score: 925 E_value: 5e-98
KOG Definition: No Hit Found
PFAM Definition: TauD, Taurine catabolism dioxygenase TauD, TfdA family. This family consists of taurine catabolism dioxygenases of the TauD, TfdA family. TauD from E. coli is a alpha-ketoglutarate-dependent taurine dioxygenase. This enzyme catalyses the oxygenolytic release of sulfite from taurine. TfdA from Burkholderia sp. is a 2,4-dichlorophenoxyacetic acid/alpha-ketoglutarate dioxygenase. TfdA from Alcaligenes eutrophus JMP134 is a 2,4-dichlorophenoxyacetate monooxygenase. Also included are gamma-Butyrobetaine hydroxylase enzymes EC:1.14.11.1..
Pfam Number: pfam02668 Score: 615 E_value: 2e-64
Swissprot: P37610|TAUD_ECOLI
Gene Ontology:
GO:0000908 = Molecular function: taurine dioxygenase activity

Sequence:
>Contig434
TTGGAACGGCCCCTACAACACAGAAGAAAACAATCTCGCAATATAACATT
CCAAAGCCCCGGGGCCTTCACTCAGAGTATATCCATCATGTCTACCACTA
TCACCACCACTTTGCCCATCACCGAGACCCTGCCCAGCGTTCTCACAGTC
AAAGACGAGTCCACTCGCAACAAGTTCCCCACTCCTCCCAAGTACACCGG
CGCTCTCGACAAGTACGAGAAATTCGATGTCACTCGCGTCGTTGGTACCG
AGTTCAAGCAAGGTATCCAATTGGCAGAGCTTCTCAAGGCTCCCAACTCC
GATGATCTGATCCGCGATTTGGCCATCCTCGTGGCCCAGCGTGGTGTTGT
CTTCCTCCGCGCGCAGGAGATCTCCCTTCAGGAGCAGAAGGAACTTACTC
AGAAGTTGGGCGCTTTGAGCGGAAAGCCTGACAGCAGTGGGCTCCATACC
CACCCACTCACCCGCGAGTTCTCTGAACTCGGCGATGAAGTCACGGTCAT
TAGCACCGAAGGAAAGAAGGGTCTTAACCGCAGACTCCGCCCGTCCTACA
AGGATGAGCGATCCGGCCTCGCCAGCTCAGGGTGGCATATGGAGATCACT
TTCGAAGAGATTCCAAGTGACTACTCCGTCTTGAAGATGACCACCCTCCC
AGAGACTGGCGGAGACACCCTTTGGGCTTCCGCGTATGAGGCTTACGACC
GCCTCTCCCCCTCGTTCCGCCAGATACTTGAGGGCTTGACTGCCACTCAT
GACTCCCCCAGATTTGCTGAGGTGGCTGCCCGTGATGGCTTCCAGCTCAG
AACCGACCGCGGTTCTCCCCATAACGCTGGTCTCGATTTGGTTGCTGTTC
ATCCCGTTATTCGCACCAACCCCGTTACCGGATGGAAGGGCCTCTTCGTC
AATAGGGGGTTCACCCGCCGCATCAATGAGCTCACCAAGGATGAGTCCGA
CTATATGCTTGACTTCCTTTTCAAGCACGTCAGCGAGAACCACGATCTCC
AGTGCCGTTTGAAATGGATGGCATACGAAAACAAGAACGCCCATGATGTC
GCTATCTGGGATAATCGCAGTGCTTTCCACACTGCCACAGATGACTACTT
CGACTTTGGTGGTATCCGCAGAGGGACCATGTTCGTTTCCCTGGGGGAGA
AGCCCTACTTTGACCCCAACAGCAAATCCCGCCGCGTGGATTTGGGTCTT
GGTCCCTTCTCCGGCCAATTCGAATGGCTATAGACCTTGGAACTTGCGGA
GCTAGCCCCCCTGCACAGGAGAGAAAATAGCGCTCATGGCCCACTGATTC
GTTACGATTTCTTTTTTTTTTTTTGGATTGTTTTTTT

Sequences in the Contig:

SY0AAA14YA02FM1 SY0AAA16YC15FM1 SY0AAA19YP15FM1
SY0AAA24YA18FM1 SY0AAA24YA18FM2 SY0AAA25YN16FM1
SY0AAA26YN22FM1 SY0AAA27YE17FM1 SY0AAA28YC21FM1
SY0AAA33YB12FM1 SY0AAA33YP19FM1 SY0AAA34YL20FM1
SY0AAA34YM17FM1 SY0AAA34YO04FM1 SY0AAA35YK18FM1
SY0AAA37YK18FM1 SY0AAA44YG02FM1 SY0AAA46YL03FM1
SY0AAA47YL11FM1 SY0AAA50YP03FM1 SY0AAA56YI17FM1
SY0AAA59YK19FM1 SY0AAA61YI20FM1 SY0AAA7YC02FM1
SY0AAA7YO21FM1 SY0AAA8YH15FM1 SY0AAA9YE12FM1
SY0AAB16YK12FM1 SY0AAB18YI10FM1 SY0AAB20YE01FM1
SY0AAB32YJ23FM1 SY0AAB37YD03FM1 SY0AAB39YF05FM1
SY0AAB39YP18FM1 SY0AAB41YP17FM1 SY0AAB44YG19FM1
SY0AAB45YG19FM1 SY0AAB46YN11FM1 SY0AAB47YF13FM1
SY0AAB54YO07FM1 SY0AAB55YG05FM1 SY0AAB56YG23FM1
SY0AAB60YD24FM1 SY0AAB61YG15FM1 SY0AAD35YO14FM1